Ethics statement
The animal studies were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Northwest Agriculture and Forestry University (NWAFU). The animal protocols were approved by the IACUC of NWAFU (20190017/08).
Cells, viruses, and sera
Human embryonic kidney cells (HEK293T) and African green monkey kidney cells (MARC-145) cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Life Technologies Corp, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Carlsbad, CA, USA) and 1% antibiotic-antimycotic (Life Technologies Corp) at 37 °C under 5% CO2. HEK293S cells were cultured in the commercial serum-free medium (BasalMedia, Shanghai, China) supplemented with 1% antibiotic-antimycotic (Life Technologies Corp) at 37 °C and 130 rpm under 5% CO2.
Genotype 2 PRRSV strains SD16 (GenBank ID: JX087437), NADC30-like (GenBank ID: KX766379) and genotype 1 strain GZ11-G1 (GenBank ID: KF001144) were propagated and titrated in MARC-145 cells in DMEM supplemented with 3% FBS.
The 217 negative sera for anti-PRRSV antibodies were obtained from the healthy pigs and were verified to be negative via a commercial ELISA kit (IDEXX, Westbrook, ME, USA). Serum samples from the pigs challenged with PRRSV HuN4, SD16, and CH-1R strains were used to evaluate the cELISA assay [25–27]. To determine the coincidence rate of cELISA, 381 challenged sera samples were collected from our previous animal experiments [28, 29]. Meanwhile, 450 clinical sera samples were collected from various farms in Shandong and detected using both the commercial ELISA kit and cELISA.
Animal experiments
Nine four-week-old piglets were obtained from a PRRS-free farm and tested for negative PRRSV via the detection of real-time RT-PCR and anti-PRRSV antibodies [30, 31]. The piglets were randomly divided into three groups (3 pigs per group), which were separately raised in different isolation rooms. Group 1 piglets were intranasally administered with 1 × 106.5 TCID50 of PRRSV NADC30-like strain, group 2 with 2 × 105 TCID50 of PRRSV GZ11-G1 strain, and group 3 with 2 mL MARC-145 cell culture supernatant as the negative control. Serum samples were collected at 0, 1, 3, 5, 7, 10, 14, 21 and 28 days post-inoculation (dpi) then used for the detection of antibodies against PRRSV-N protein by cELISA and a commercial IDEXX ELISA kit.
Bactrian camel immunization and library construction
A four-year-old male Bactrian camel was immunized subcutaneously with the killed PRRSV (CH1a strain) with six times [32]. Every two weeks, the camel was immunized once and after six immunizations, the serum samples from the Bactrian camel was collected and detected for anti-PRRSV antibodies using iELISA. Four days after the last immunization, peripheral blood mononuclear cells (PBMCs) were isolated from 200 mL blood sample by Leucosep® tubes (Greiner Bio-One, Frickenhausen, Germany). Total RNA was extracted from the 1 × 107 PBMCs and reverse transcribed into cDNA. Then, the Camellidae heavy chain-only antibodies (VHH) genes were amplified using the cDNA as a template by nested PCR, as described previously [33]. The first PCR products (~ 700 bp) amplified with the CALL001 and CALL002 primers (Table 1) were purified according to the instructions of the EasyPure Quick Gel extraction kit (TransGen Biotech, Beijing, China). The second PCR with primers VHH-FOR and VHH-REV (Table 1) was amplified using the first purified PCR products as the template. The final purified PCR products (~ 400 bp) were ligated into the phagemid vector pMECS with Not I and Pst I enzymes sites by T4 DNA ligase (NEB, Ipswich, MA, USA). Then, the ligation products were electro-transformed into competent E. coli TG1 cells. Cells were cultured on LB agar plates with 2% glucose and 100 µg/mL ampicillin at 37°C overnight. Subsequently, the bacterial colonies were scraped from the plates, re-suspended in phosphate buffer saline (0.01 M PBS, pH 7.2) to prepare the VHH phage library against PRRSV, and stored at -80°C.
Table 1
Primers used in this study
Primers | Sequence (5’- 3’) | Usage |
CALL001 | GTCCTGGCTGCTCTTCTACAAGG | Overlap-VHH |
CALL002 | GGTACGTGCTGTTGAACTGTTCC |
VHH-FOR | CAGGTGCAGCTGCAGGAGTCTGGGGGAGR |
VHH-REV | CTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT |
PRRSV-N-F | CGCGGATCCATGCCAAATAACAACGGCAAGC | pET28a-PRRSV-N |
PRRSV-N-R | CCCAAGCTTTCATGCTGAGGGTGATGCTGTG |
Nb-F | AACTGCAGATGGAGACCGACACC | pCMV-N1-Nbs-HRP |
Nb-R | ATAAGAATGCGGCCGCTTAGTGGTGATGGTG |
Note: Restriction sites are underlined |
Expression and purification of recombinant PRRSV capsid protein
The ORF7 gene encoding the PRRSV-N protein was amplified using an infectious PRRSV cDNA clone pBAC-SD16 as the template [34]. The PCR products were purified and cloned into the pET-28a prokaryotic expression vector (Novagen, Darmstadt, Germany). After sequencing, the recombinant positive plasmid was named pET28a-N. The primers of PCR amplification are listed in Table 1. After the pET28a-N plasmids were transformed into E. coli BL21 (DE3) (TransGen Biotech, Beijing, China), the recombinant PRRSV-N protein was expressed and purified based on the previous descriptions [35]. Briefly, the positive bacteria were induced with 0.1 mM isopropyl-β-thiogalactopyranoside (IPTG) for 6 h at 37°C. The bacteria were collected and re-suspended in Buffer A (20 mM Tris, 300 mM NaCl, pH 7.2–7.4). The supernatant of bacterial solution was collected after the induced bacteria were ultrasonicated and centrifuged. Subsequently, the supernatant containing recombinant PRRSV-N protein was purified using a Ni-NTA column (Roche, Mannheim, Germany) and eluted with Buffer B (20 mM Tris, 300 mM NaCl, and 250 mM imidazole, pH 7.2–7.4). Finally, the expression, purification, and antigenicity of the recombinant PRRSV-N protein were analyzed by SDS-PAGE and Western blot with the positive pig sera for PRRSV.
Screening and identification of PRRSV-N specific nanobodies
The PRRSV-N protein specific nanobodies were screened by three rounds of panning using phage display technology, as previously described, with the following modifications [32]. Briefly, the VHH phage library was rescued via M13K07 helper phage. The 96-well plates (Nunc, Denmark) were coated with the recombinant PRRSV-N protein (4 µg/well) overnight at 4°C for the three rounds of panning. The coated plates were blocked with 200 µL of 2.5% skim milk at 37°C for 1 h and washed with 0.05% PBS’T (1 L PBS with 0.5 mL Tween-20). Then, the above rescued recombinant phage (5 × 1011 pfu/mL) were added to the plates and incubated at room temperature (RT) for 1 h. After the plates were washed again, the binding phages were eluted using 100 µL 0.1 M trimethylamine (Sigma, St. Louis, MO, USA) and neutralized with same volume of 1 M Tris-HCl (pH 7.4). Subsequently, the growth log phase of E. coli TG1 was infected with the eluted phages and amplified for further rounds of selection. The enrichment of specific phage particles was analyzed using anti-M13/HRP conjugate ELISA combined with phage titration after three rounds of panning. Finally, the 96 colonies were picked randomly and induced with IPTG (1 mM) to express soluble VHHs with an HA-Tag. These recombinant VHHs-HA-Tag proteins were extracted and tested for their capacity to recognize the PRRSV-N protein using iELISA with an anti-HA-Tag antibody as the first antibody (GenScript, Biotech Corp, China). Finally, the positive clones were sequenced, and the nanobodies were grouped according to the hypervariable complementary-determining region 3 (CDR3) sequence.
Establishment of HEK293S cell lines stable expression of nanobody-HRP fusion protein
To select the best nanobody to construct the stably expressed cells for producing the nanobody-HRP fusion protein, the different fusion proteins were first expressed with transient transfection. The recombinant plasmids were constructed based on the previous descriptions [10, 36]. The VHH gene was amplified using primers Nb-F and Nb-R (Table 1) with pMECS-VHH plasmid as the template. Then, the PCR products and pCMV-N1-HRP vector were both digested via the Pst I and Not I enzymes and ligated with T4 ligation enzymes to create the recombinant pCMV-N1-Nbs-HRP plasmids. Next, the HEK293T cells were transfected with the recombinant plasmids to produce the nanobody-HRP fusion proteins using polyetherimide (PEI, Warrington, USA) agents. The cell supernatant containing nanobody-HRP fusion proteins were collected after transfection for 60–72 h. The cELISA procedure was used to select the best nanobody, which is described below. The highest percent competitive inhibition (PI) values of the nanobody-HRP fusion protein were select for constructing the stably expressing cells.
The platform of HEK293S cell line stably expressing the nanobody-HRP fusion proteins was designed as following: the secreting signal sequence, an HA tag, VHH, HRP and His tag sequence were obtained from the pCMV-N1-Nbs-HRP with the digestion of enzymes EcoR I and BamH I. Then, the gene was ligated into pLVX-IRES-ZsGreen lentivirus vector digested with the same two enzymes. To produce lentivirus particles, the HEK293T cells were co-transfected with pLVX-IRES-ZsGreen-Nb-HRP, psPAX2 and pMD2.0G plasmids using X-tremeGENE HP DNA Transfection Reagent (Roche, Basel, Switzerland) according to the manufacturer’s instructions. After transfection for 60 h, the packaging lentivirus was observed under a fluorescence microscope, and the cell culture supernatant was collected. HEK293S cells were transduced using the above recombinant lentiviruses and supplemented with 10 µg/ml of PolyBrene (Sigma, St. Louis, MO, USA). After 48 h, the transduced cells were observed under a fluorescence microscope. Then, HEK293S cells with green fluorescence were sorted by High-speed sorting flow cytometer (BD, US).
Biological activity analysis of nanobody-HRP fusion proteins produced by the two systems
The biological activity (titres and stability) of nanobody-HRP fusion proteins produced by the transient transfection and stable expressing system were compared. Firstly, the titers of the nanobody-HRP fusion proteins from the two systems were tested with direct ELISA using a checkerboard titration. Different amounts of the PRRSV-N protein, i.e. 100, 200, 400, and 800 ng/well, were coated into the 96-well plates, and the different dilution ratios of the nanobody-HRP fusions (1:10, 1:100, 1:500, and 1:1000) were tested. The titer was assessed when the OD450nm value of the direct ELISA was 1.0, and the stability of the fusion proteins produced by the two systems was also evaluated. The two methods were independently repeated five times for producing the fusion proteins. Then, the fusion proteins from the different production batches were detected using direct ELISA with a 1:100 dilution. Subsequently, the stability of fusion proteins from the stable expression system was tested from the second, forth, sixth, eighth, and tenth generations and the supernatants from these generations were detected using direct ELSIA with dilutions of 1:10, 1:100, and 1:1000. In addition, the operations of the two systems were compared based on the procedures for producing the fusion proteins.
Development of competitive ELISA using nanobodyHRP fusion proteins for detecting anti-PRRSV antibodies
The cELISA was developed using the nanobody-HRP fusion proteins as a probe according to a reported procedure [10]. Firstly, the optimal amount of antigen and dilution of fusion protein were determined using a checkerboard titration test with direct ELISA. Different amounts of the PRRSV-N protein (100, 200, 400, and 800 ng/well) were coated into the 96-well plates, then the dilution ratios of fusion proteins of 1:10, 1:100, 1:500, 1:1000 were tested. Finally, the optimal amount of antigen and fusions were selected when the OD450nm value of the direct ELISA was 1.0 and the amount of coated antigen was the lowest. Secondly, the optimal dilution ratio of pig sera was determined. Five separate positive and negative pig sera were diluted at 1:10, 1:20, 1:40, 1:80, and 1:160 and tested with the cELISA. The optimal serum dilution was determined according to the smallest ratio of OD450nm values between the positive and negative sera (P/N). Finally, the times of incubation and color reaction after the addition of tetramethylbenzidine (TMB) were separately optimized. The incubation times of the mixtures containing the nanobody-HRP fusions and the positive or negative sera with coated PRRSV-N protein were tested at 20, 30, and 40 min. After incubation, TMB was added to color and tested after 10, 15, and 20 min. The smallest ratio of OD450nm values between the positive and negative sera was selected as the optimal incubation and colorimetric reaction times.
After optimizing the above conditions, cELISA was performed as follows. (1) The 96-well ELISA plate was coated with the optimal amount of PRRSV-N recombinant protein and incubated overnight at 4°C. (2) The plate was blocked with 200 µL 2.5% (w/v) non-fat dry milk in PBS’T at room temperature (RT) for 1 h after washed three times with PBS’T. (3) After washed with PBS’T again, each well was added into 100 µL of testing mixtures containing the optimal dilutions of serum sample and nanobody-HRP fusions in 2.5% (w/v) non-fat dry milk, then incubated for optimal times at RT. (4) After the plate was washed again in the same way, TMB (100 µL/well) was added and incubated for optimal times at RT. (5) Finally, 3 M H2SO4 (50 µL/well) was used to stop the colorimetric reaction, and the OD450nm values were read using an automated ELISA plate reader (Bio-Rad, USA).
Determination of cut-off value, sensitivity, specificity and repeatability of the cELISA
The PI values were calculated with following formula: PI (%) = [1-(OD450nm value of testing serum sample/OD450nm value of negative sample)] × 100%. The 217 negative pig serum samples for anti-PRRSV antibodies were used to determine the cut-off value. After these sera were detected using the developed cELISA, the cut-off value was calculated by the mean PI of 217 negative serum samples plus 3 standard deviations to ensure 99% confidence for the negative sera samples within this range [37].
The sensitivity of cELISA was evaluated by testing sera from the different dpi of the three challenged NADC30-like PRRSV pigs as well as the 164 PRRSV-clinical positive sera confirmed by the commercial ELISA kit. In addition, double dilutions (from 1:10 to 1:5120) of five positive pig sera for anti-PRRSV antibodies were tested using cELISA to determine the lowest detection dilution.
The specificity of the cross-competing assay was assessed between the nanobody-HRP fusions and antibodies against other swine viruses, including porcine parvovirus (PPV), porcine circovirus type 2 (PCV2), porcine pseudorabies virus (PRV), transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), and swine influenza virus (SIV). Standard positive sera for anti-the other swine viruses antibodies were confirmed by the commercial ELISA kit. Total 164 PRRSV-clinical negative sera were also tested with the cELISA. To further confirm whether cELISA can detect anti-genotype 1 PRRSV antibodies, the sera from the pigs pre- and post-challenged with GZ11-G1 strain (genotype 1) were tested. Meanwhile, the sera samples from the pigs challenged with HuN4, SD16, and CH-1R strains of genotype 2 PRRSV strains were evaluated to determine whether cELISA can detect antibodies against different genotype 2 PRRSV isolates.
To determine the reproducibility of cELISA, eight separate positive and negative clinical pig serum samples were tested and used to perform the intra-assay and inter-assay variabilities. The inter-assay variation (between plates) and intra-assay variation (within a plate) were evaluated by the coefficient of variation (CV). Each sample was tested using three different plates to determine the inter-assay CV, while three replicates within each plate were used to calculate the intra-assay CV [38].
Comparisons of competitive ELISA with commercial ELISA kit
To evaluate the coincidence of cELISA with the commercial ELISA kit, 381 serum samples from challenged pigs with PRRSV and 450 clinical pig serum samples were tested with each method and analyzed via SPSS software. Among these sera, the results reveal inconsistencies between the two detection methods for these, thus IFA verification was subsequently performed.
Statistical analysis
Statistical analysis was performed using GraphPad Prism version 5.0 (GraphPad Software, San Diego, CA, USA). Student’s t-test and Kappa index values were calculated to estimate the platform for HEK293S cell lines stably expressing nanobody-HRP fusion protein, as well as the coincidence between cELISA and the commercial ELISA kit. Repeatability was assessed using CV (CV = SD/Mean), where a CV value less than 15% for the intra-plate assay was considered an acceptable repeatability level for the assay. These calculations were performed using SPSS software (Version 20, http://www.spss.com.cn).