MiR-133a-3p Functions as a Tumor Suppressor in Colorectal Cancer by Targeting PFKFB3

doi:10.21203/rs.3.rs-566251/v1

Download PDF

Primary research

MiR-133a-3p Functions as a Tumor Suppressor in Colorectal Cancer by Targeting PFKFB3

https://doi.org/10.21203/rs.3.rs-566251/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background: Recent studies reveal that PFKFB3 plays an important role in tumorigenesis and tumor progression. Our study aims to identify an novel microRNA which can suppress the expression of PFKFB3 and to provide a potential target for tumor therapy.

Methods: Bioinformatics methods were implemented to explore the expression and clinical significance of PFKFB3 and miR-133a-3p in colorectal cancer (CRC). qRT-PCR was performed to detect PFKFB3, miR-133a-3p, KI67 and MMP9 mRNA expression, while western bot was carried out for the detection of protein expression of PFKFB3, miR-133a-3p, KI67 and MMP9. Bioinformatics analysis was used to predict the binding sites of miR-133a-3p on PFKFB3 3’UTR, while dual-luciferase assay was conducted to validate their binding relationship. CCK-8 assay, KI67 detection, Transwell assay and MMP9 detection were employed to measure CRC cell proliferative and invasive abilities.

Results: PFKFB3 is up-regulated in CRC and significantly associated with poor prognosis. Overexpressed PFKFB3 promotes CRC cell proliferation and invasion. miR-133a-3p is down-regulated and has diagnostic value in CRC. Dual-luciferase assay confirmed that there was a binding relationship between miR-133a-3p and PFKFB3.Overexpressed miR-133a-3p remarkably reduced PFKFB3 expression in CRC cells, weakened the promoting effect of PFKFB3 on cell proliferation and invasion.

Conclusions: Our study suggests that miR-133a-3p functions as a novel tumor suppressor in colorectal cancer by targeting PFKFB3.

General Biochemistry

Oncology

miR-133a-3p

PFKFB3

Colorectal cancer

SW480

Colorectal cancer (CRC) was the most commonly diagnosed gastrointestinal cancer, representing 1.8 million cases and 881,000 deaths globally, and constituting 1 in 10 cancer cases and deaths [1]. Advancements in pathophysiological understanding have increased the array of treatment options for local and advanced disease leading to individual treatment plans. Although these new treatment options have doubled overall survival for advanced disease to 3 years, survival is still best for those with non-metastasised disease. As the disease only becomes symptomatic at an advanced stage, worldwide organised screening programmes are being implemented, which aim to increase early detection and reduce morbidity and mortality from colorectal cancer [2]. Additionally, although all-ages rates of colorectal cancer have largely stabilized or been in decline in high-income countries, incidence rates appear to be rising in adults younger than 50 years. Although genetic, lifestyle, obesity, and environmental factors might have some association, the exact reasons for this increase are not completely understood [3].

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFK-2/FBPase 3, PFKFB3) is a member of a homodimeric and bifunctional enzyme family (PFKFB1-4) [4], which contorls the intracellular steady-state concentration of fructose 2,6-bisphosphate(F2,6P2) [5]. F2,6BP is a potent actibator of PFK-1, and PFK-1 is essential for the rate-limiting step of glycolysis [6]. The bifunctional isoenzyme encoded by the pfkfb3 gene has the highest kinase: phosphatase activity ratio, which in turn sustains high glycolytic rates [7]. PFKFB3 expression could be upregulated in response to mitogenic, inflammatory and hypoxia stimuli and during the DNA synthesis phase of the cell cycle.18 Considering its significance in cancer metabolism, further explanation of the function of PFKFB3 in diverse cancers is necessary. According to previous studies, the expression of PFKFB3 gene can be regulated by different mechanisms such as signal pathways, oncogenes, noncoding RNAs, inflammatory molecules, and the PFKFB3 protein regulated both at the transcriptional and post-transcriptional levels. Although the glycolytic role of PFKFB3 in cancer progression has been the subject of numerous functional studies, some researchers have also focused on the functions of PFKFB3 beyond glycolysis. PFKFB3 expression may not only be essential for the regulation of glycolysis in the cytoplasm, but also in the control of the cell cycle in the nucleus and maintenance of an anti-apoptotic state. PFKFB3 has been suggested to play a crucial role in many types of tumor cells as well as various cells in the tumor microenvironment.

miRNAs, a class of noncoding RNA (ncRNA) about 22-nucleotide RNAs in size, are highly conserved molecules regulating gene expression post-transcriptionally by binding to the 3’-untranslated region (3’-UTR) of target message RNAs (mRNAs) [8] and participating tumorigenesis, proliferation, invasion and drug resistance in cancer [9].

miR-133a-3p, which belongs to the miR-133 family, was first experimentally characterized in mice [10]. In the human genome, miR-133a-3p is a multicopy gene, with two known copies: miR-133a-1 and miR-133a-2, located on chromosomes 18, 20 respectively. To date, multiple functional roles of miR-133a-3p have been elucidated, such as regulating myoblast proliferation and differentiation [11], inhibiting embryonic cardiomyocyte proliferation [12]and avoiding genetic cardiac hypertrophy [13].Furthermore, it has been reported that miR-133a-3p is among the most frequently downregulated miRNAs in various types of human malignancies, which suggested that miR-133a-3p may serve a critical part in tumor progression of various malignancies, including non-small cell cancer [14], ovarian cancer [15], colorectal cancer [16], bladder cancer [17], breast cancer [18] and prostate cancer [19].

In this study, we predicted PFKFB3 was a target gene of miR-133a-3p by bioinformatics analysis. qRT-PCR, western blot and luciferase assays were used to verify the relationship between PFKFB3 and miR-133a-3p, and CCK8 assay and transwell assay were applied to elucidate the effect of the miR-129-5p/PFKFB3 axis on the occurrence and development of CRC. Overall, our results demonstrated that miR-133a-3p suppresses the progression of GCs by targeting PFKFB3.

Bioinformatic analysis

The online databases Oncomine (https://www.oncomine.org/resource/login.html), TCGA (https://portal.gdc.cancer.gov/) and THPA (https://www.proteinatlas.org/) were applied to explore the expression level and clinical significance of PFKFB3 in CRC. Target miRNA prediction for PFKFB3 was performed by the TargetScan (http://www.targetscan.org/vert 72/) (19) and ONCOMIR (https://www.biosino.org/dbDEMC/index) websites. The expression and clinical data of miR-133a-3p were obtained from the TCGA-COAD dataset.

Cell culture

Five CRC cell lines (LDL1, LOVO, HT29, SW480, CaCO-2) and a normal human normal colonic epithelial cell line (NCM460) were obtained from the Chinese Academy of Sciences (Shanghai, China). All cell lines were cultured in DMEM medium (Thermo Fisher Scientific, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin, and incubated at 37℃and 5% CO2.

Cell transfection

The oligonucleotides of miR-133a-3p mimics, mimics control, miR-133a-3p inhibitor, control inhibitor, PFKFB3 overexpression vector and PFKFB3 siRNA were purchased from HIPPOBIO (China) were transfected into CRC cell line SW480 by Lipo2000 (ThermoFisher, USA) kit in accordance with instructions. After 24h of transfection, transfected cells were used for subsequent experiments.

Reverse transcription-quantitative polymerase chain reaction

Total RNA was isolated from cells using TRIzol kit (Life Technologies, USA). The cDNA was synthesized using PrimeScript™ RT Master Mix Kit for qPCR (TaKaRa, Japan) and miRNA First Strand cDNA Synthesis (Sangon Biotech, China) according to relevant protocols. miR-133a-3p, PFKFB3, KI67 and MMP9 mRNA levels were quantified using Power SYBR™ Green PCR Master (Invitrogen, USA) with StepOne Plus Realtime PCR system. U6 and Actin were used as an internal standard control for miRNA and mRNA detection, respectively. Primer sequences used in qRT-PCR were listed in Table 1. The relative expression of miR-133a-3p and PFKFB3 mRNA was presented by 2^−ΔΔCt method. The experiment was repeated for three times.

Table 1 Primer sequences used in qRT-PCR

Gene	Primer sequence
miR-133a-3p	Foward	TTTGGTCCCCTTCAACCAGCTG
U6	Foward	ATTGGAACGATACAGAGAAGATT
	Reverse	GGAACGCTTCACGAATTTG
PFKFB3	Foward	AAACTGACGCCTGTCGCTTA
	Reverse	CCGGGAGCCTTTCATGTTTTG
KI67	Foward	ATGGAGAGGTGGCCAAGAAC
	Reverse	TGTGTGGTCTGTGTGAGCTG
MMP9	Foward	GGTGATTGACGACGCCTTTG
	Reverse	GGACCACAACTCGTCATCGT
Actin	Foward	GGACTTCGAGCAAGAGATGG
	Reverse	AGCACTGTGTTGGCGTACAG

Western blot analysis

Total proteins were harvested after cells were lysed by RIPA lysis buffer, and protein concentration was assayed by BCA kit (Beyotime, China). After being denatured at a high temperature, proteins were isolated by sodium dodecyl sulfate-polyacrylamide gelelectrophoresis (SDS-PAGE) and transferred onto polyvinylidene fuoride membranes (PVDF; Millipore), which were then blocked with 5% skim milk for 2 h. Then the membranes were

incubated with primary antibodies overnight at 4℃. Rabbit anti-PFKFB3 (ET1705-66, 1:1000, HUABIO), rabbit anti-KI67 (ab16667, 1:1000, Abcam), rabbit anti-MMP9 (ab76003, 1:1000, Abcam) and mouse anti-β-Actin (EM21002, 1:5000, HUABIO) .antibodies were added and incubated at 4℃ overnight. Subsequently, the membranes were incubated with secondary antibody goat anti-mouse IgG (1:5000, D110058, BBI) and goat anti-rabbit IgG (1:5000, D110057, BBI). After culture for 2 h at room temperature, all protein bands were visualized using an enhanced chemiluminescence kit (GE Healthcare, USA).

Cell proliferation assay

The cell proliferation ability of SW480 cells was measured using the cell counting kit-8 assay (CCK-8) (MCE, USA ). Cells were counted and seeded into the 96-well plate with 3,000 cells/well, and then incubated with 5% CO2 at 37 ℃ for 72 h. The absorbance of cultured CRC cells was measured with the micro-plate reader at 450 nm after CCK-8 solution addition for 2 h.

Transwell invasion assay

The 24-well transwell chambers (Corning, NY, USA) with or without the Matrigel (Invitrogen) were used to perform the transwell assays. 1×10⁵ SW480 cells were seeded into the upper chambers in serum-free medium, while the serum-supplied medium was added to the lower chamber in 24-well plates. After being cultured for 48 h at 37 ℃, the non-invaded cells were removed, while the invaded cells were stained with 0.1% crystal violet. Numbers of stained cells in the bottom chambers were assessed from five randomly selected fields, and the data were summarized from three individual experiments. The experiment was conducted for three times.

Luciferase reporter assay

To determine the binding relationship between miR-133a-3p and PFKFB3 3’-UTR, luciferase vectors pmirGLO (Promega, USA) fused with wild type (WT) SPN 3’-UTR or mutant (MUT) SPN 3’-UTR were established. These constructed vectors were cotransfected with miR-133a-3p mimic or mi-NC into SW480 cells using Lipofectamine 2000. Then, 48 h after transfection, the luciferase activity was detected using a dual-luciferase reporter assay system (Promega, United States).

Statistical analysis

All experiments were executed at least three independent times. The statistical data are presented as mean ± standard deviation and analyzed using GraphPad Prism 6.0 (CA, United States). Two-tailed Student’s t-tests were conducted to interpret the differences.. P value <0.05 was considered statistically significant.

PFKFB3 is up-regulated in CRC and significantly associated with poor prognosis

To explore the expression of PFKFB3 mRNA and protein in CRC cells, online databases ONCOMINE, TCGA and THPA were used. We found that PFKFB3 mRNA is up-regulated in 7 types of tumors including colorectal cancer (Fig. 1a). The TCGA-COAD data showed that PFKFB3 mRNA was prominently up-regulated in CRC tissue (Fig. 1b). The THPA data showed the PFKFB3 protein is high expressed in colorectal cancer (Fig. 1c). For further confirmation, we detected the expression of PFKFB3 mRNA and protein in five CRC cell lines (LDL1, LOVO, HT29, SW480, CaCO-2) and a normal human normal colonic epithelial cell line (NCM460). The results showed that PFKFB3 is up-regutated in all the five CRC cell lines(Fig. 1d.e). In addition, according to the K-M survival curve plotted by THPA online tool, the up-regulated PFKFB3 is significantly associated with poor prognosis (Fig. 1f).

PFKFB3 affects CRC cell proliferation and invasion

To evaluate weather PFKFB3 contributes to the progress of CRC, we established the PFKFB3 overexpressed and silenced CRC cell lines via SW480. We first confirmed the expression of PFKFB3 by qRT-PCR and western blot (Fig. 2a-b). CCK8 assay and KI67 detection suggested that overexpression of PFKFB3 markedly enhanced CRC cell proliferative ability, while silencing of PFKFB3 inhibited the proliferation of CRC cells (Fig, 2d-f). Transwell assay and MMP9 detection demonstrated that overpxpress of PFKFB3 promotes the invasion of CRC cells, on the contrary silencing of PFKFB3 supressed the inbasion of CRC cells (Fig. 2g-i). Taken together, these results domonstrated that PFKFB3 enhanced CRC cell proloferation and invasion.

Low expression of miR-133a-3p has diagnostic value in CRC

The online batabases Targetscan and ONCOMIR were applied to predict the regulating miRNAs of PFKFB3, we combined the prediction results of two databases. As a result, miR-26-5p and miR-133a-3p were selected as potential regulators of PFKFB3(Additional file2). To explore the expression of these microRNAs in CRC, a TCGA-COAD dataset was analysed. The results showed that miR-26a-5p and miR-26b-5p is up-regulated in colorectal cancer, while miR-133a-3p is down-regulated in colorectal cancer (Fig. 3a-c). Further more, we validated the expression level of miR-133a-3p in normal colonic epithelial cell(NCM460) and CRC cell line SW480. Additionally a ROC diagnostic curver plotted by TCGA data demonstrated that low expression of miR-133a-3p has diagnostic value in colorectal cancer

miR-133a-3p directly targets PFKFB3

To further explore the regulatory efect of miR-133a-3p on PFKFB3, bioinformatics analysis was used to predict the binding sites of miR-133a-3p on PFKFB3 3’-UTR, indicating that there were binding sites between miR-133a-3p and PFKFB3 (Fig. 4a). Subsequently, dual-luciferase assay validated the targeted binding relationship between miR-133a-3p and PFKFB3, finding that overexpression of miR-133a-3p inhibited the luciferase activity of PFKFB3-WT 3’-UTR, while had no infuence on that of PFKFB3-MUT 3’-UTR (Fig. 4b). Taken together, these fndings elucidated that miR-133a-3p targeted and down-regulated PFKFB3 in CRC cells.

miR-133a-3p Inhibites the Proliferation and Invasion of CRC cells by targeting PFKFB3

To investigate whether miR-133a-3p regulates CRC cell behaviors by targeting PFKFB3, we established miR-mimics (mimics + control), miR-inhibitor (inhibitor + control) and PFKFB3-OE (miR-mimics + PFKFB3-OE) groups. qRT-PCR and western blot were used to assess PFKFB3 expression in diferent groups, finding that PFKFB3 was potently down-regulated by miR-133a-3p in miR-mimics and PFKFB3-OE groups (Fig. 5a, b). CCK8 assay and KI67 detection suggested that the proliferative ability of CRC cells was supressed by miR-133a-3p in miR-mimics and PFKFB3-OE groups (Fig. 5d-f). Transwell assay and MMP9 detection demonstrated that miR-133a-3p mimics can inhibite the invasion of CRC cells in miR-mimics and PFKFB3-OE groups(Fig. 5g-i). On the contrary, when miR-133a-3p was inhibited, its inhibitory effect on cell proliferation and invasion disappeared. Collectively, it could seen that miR-133a-3p supressed cell proliferation and invasion via targeting PFKFB3.

In recent years, PFKFB3 has been studied in various cancer cells. Most studies have demonstrated that the overexoression of PFKFB3 promoted cancer cell growth, proliferation, migration and metastasis [20]. In addition, inhibition of PFKFB3 expression by siRNA [21], miRNA [22] and inhibitor [23] decreases the growth, proliferation and migration of these cells. In this study we found that PFKFB3 was significantly up-regulated in CRC by bioimformatics analysisi and cell experiments. Besides, according to our study PFKFB3 could act as a promoter to CRC cell proliferation and invasion. These findings provide a better understood to the regulatory mechanism of PFKFB3 in CRC.

Despite several different kinds of miRNAs, such as miR-206, miR-26b, and miR-330 have been reported to decrease the expression of PFKFB3 [23–24]. We identify a novel miRNA targeting PFKFB3 by combining the bioinformatics prediction results and TCGA expression data. Our research showed miR-133a-3p is significantly down-regulated in CRC and SW480 cell line, and the detection of miR-133a-3p has diagnostic value in CRC. miR-133a-3p has been reported as a supressor of several different oncogenes such as COL1A1, CORO1C and CREB1 [25–27], The regulatory mechanism of the miR-133a-3p/PFKFB3 axis in CRC have not been reported to date. As revealed by cell experiments, we found that PFKFB3 can be supressed by miR-133a-3p mimics. Dual-luciferase assay further validated that there was a targeted binding relationship between miR-133a-3p and PFKFB3. Additionally, rescue experiments indicated that miR-133a-3p suppressed CRC cell proliferation and invasion by targeting PFKFB3.

We identify miR-133a-3p as a novel biomarker in CRC, and also an suppressor of cell proliferation and invasion in CRC, wherein the targeted PFKFB3 plays a critical role. These fndings illustrate the regulatory mechanism of miR-133a-3p and PFKFB3 in CRC and provide novel potential therapeutic targets for CRC

additional insight into the exploration of new biomarkers and target therapies for ccRCC.

However, the molecular mechanisms of miR-133a-3p function in CRC cell proliferation and invasion are not fully unveiled, suggesting that other targets such as lincRNAs may exit to mediate its function. Further research is needed to better exploit miR-133a-3p as a therapeutic target in CRC treatment.

CRC: Colorectal cancer

COAD: Colon adenocarcinoma

PFKFB3: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Availability of data and materials

The datasets analyzed for this study were obtained from Oncomine (https://www.oncomine.org/resource/login.html), TCGA (https://portal.gdc.cancer.gov/) and THPA (https://www.proteinatlas.org/) and THPA (https://www.proteinatlas.org/).

Competing interests

The authors declare that they have no competing interests

Funding

The Wuxi science and Technology Development Fund (grant numbers NZ2019042)

The Jiangyin People’s Hospital Specialized Reserve Fund

Authors' contributions

Yanjie Zhou and Lu Jiang designed this study and drafted the manuscript. Yuanjun Cai and Wendong Tang performed the experiments. Ke Wang analyzed the data in this study. All authors reviewed the final version of the manuscript.

Acknowledgements

Thanks to the fund (Wuxi science and Technology Development Fund and Jiangyin People’s Hospital Specialized Reserve Fund ) for supporting this research.

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. Cancer J Clin. 2018;68:394–424.
Brody H. Colorectal cancer. Nature. 2015;521:1.
Arnold M, Abnet CC, Neale RE, Vignat J, Giovannucci EL, McGlynn KA, Bray F. Global Burden of 5 Major Types of Gastrointestinal Cancer. Gastroenterology. 2020;159:335–49.e15.
El-Maghrabi MR, Noto F, Wu N, Manes N: 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase: suiting structure to need, in a family of tissue-specific enzymes. Current opinion in clinical nutrition and metabolic care 2001, 4:411–418.
Okar DA, Manzano A, Navarro-Sabatè A, Riera L, Bartrons R, Lange AJ: PFK-2/FBPase-2: maker and breaker of the essential biofactor fructose-2,6-bisphosphate. Trends in biochemical sciences 2001, 26:30–35.
Weber G. Enzymology of cancer cells (first of two parts). N Engl J Med. 1977;296:486–92.
Sakakibara R, Kato M, Okamura N, Nakagawa T, Komada Y, Tominaga N, Shimojo M, Fukasawa M: Characterization of a human placental fructose-6-phosphate, 2-kinase/fructose-2,6-bisphosphatase. Journal of biochemistry 1997, 122:122–128.
Cho WCS. MicroRNAs: potential biomarkers for cancer diagnosis, prognosis and targets for therapy. Int J Biochem Cell Biol. 2010;42:1273–81.
Melo SA, Esteller M. Dysregulation of microRNAs in cancer: playing with fire. FEBS Lett. 2011;585:2087–99.
Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T. Identification of tissue-specific microRNAs from mouse. Current biology: CB. 2002;12:735–9.
Koutsoulidou A, Mastroyiannopoulos NP, Furling D, Uney JB, Phylactou LA. Expression of miR-1, miR-133a, miR-133b and miR-206 increases during development of human skeletal muscle. BMC Dev Biol. 2011;11:34.
Babiarz JE, Ravon M, Sridhar S, Ravindran P, Swanson B, Bitter H, Weiser T, Chiao E, Certa U, Kolaja KL. Determination of the human cardiomyocyte mRNA and miRNA differentiation network by fine-scale profiling. Stem Cells Dev. 2012;21:1956–65.
Li Y, Cai X, Guan Y, Wang L, Wang S, Li Y, Fu Y, Gao X, Su G. Adiponectin Upregulates MiR-133a in Cardiac Hypertrophy through AMPK Activation and Reduced ERK1/2 Phosphorylation. PloS one. 2016;11:e0148482.
Wang L-K, Hsiao T-H, Hong T-M, Chen H-Y, Kao S-H, Wang W-L, Yu S-L, Lin C-W. Yang P-C: MicroRNA-133a suppresses multiple oncogenic membrane receptors and cell invasion in non-small cell lung carcinoma. PloS one. 2014;9:e96765.
Guo J, Xia B, Meng F, Lou G. miR-133a suppresses ovarian cancer cell proliferation by directly targeting insulin-like growth factor 1 receptor. Tumour biology: the journal of the International Society for Oncodevelopmental Biology Medicine. 2014;35:1557–64.
Zhang W, Liu K, Liu S, Ji B, Wang Y, Liu Y. MicroRNA-133a functions as a tumor suppressor by targeting IGF-1R in hepatocellular carcinoma. Tumour biology: the journal of the International Society for Oncodevelopmental Biology Medicine. 2015;36:9779–88.
Yoshino H, Chiyomaru T, Enokida H, Kawakami K, Tatarano S, Nishiyama K, Nohata N, Seki N, Nakagawa M. The tumour-suppressive function of miR-1 and miR-133a targeting TAGLN2 in bladder cancer. British journal of cancer. 2011;104:808–18.
Cui W, Zhang S, Shan C, Zhou L, Zhou Z. microRNA-133a regulates the cell cycle and proliferation of breast cancer cells by targeting epidermal growth factor receptor through the EGFR/Akt signaling pathway. FEBS J. 2013;280:3962–74.
Kojima S, Chiyomaru T, Kawakami K, Yoshino H, Enokida H, Nohata N, Fuse M, Ichikawa T, Naya Y, Nakagawa M, Seki N. Tumour suppressors miR-1 and miR-133a target the oncogenic function of purine nucleoside phosphorylase (PNP) in prostate cancer. British journal of cancer. 2012;106:405–13.
Shi L, Pan H, Liu Z, Xie J, Han W. Roles of PFKFB3 in cancer. Signal transduction targeted therapy. 2017;2:17044.
Calvo MN, Bartrons R, Castaño E, Perales JC, Navarro-Sabaté A, Manzano A. PFKFB3 gene silencing decreases glycolysis, induces cell-cycle delay and inhibits anchorage-independent growth in HeLa cells. FEBS Lett. 2006;580:3308–14.
Ge X, Lyu P, Cao Z, Li J, Guo G, Xia W, Gu Y. Overexpression of miR-206 suppresses glycolysis, proliferation and migration in breast cancer cells via PFKFB3 targeting. Biochem Biophys Res Commun. 2015;463:1115–21.
Chen L, Zhao J, Tang Q, Li H, Zhang C, Yu R, Zhao Y, Huo Y, Wu C. PFKFB3 Control of Cancer Growth by Responding to Circadian Clock Outputs. Scientific reports. 2016;6:24324.
Du J-Y, Wang L-F, Wang Q, Yu L-D: miR-26b inhibits proliferation, migration, invasion and apoptosis induction via the downregulation of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase-3 driven glycolysis in osteosarcoma cells. Oncology reports 2015, 33:1890–1898.
Han S, Ding X, Wang S, Xu L, Li W, Sun W. miR-133a-3p Regulates Hepatocellular Carcinoma Progression Through Targeting CORO1C. Cancer management research. 2020;12:8685–93.
He B, Lin X, Tian F, Yu W, Qiao B. MiR-133a-3p Inhibits Oral Squamous Cell Carcinoma (OSCC) Proliferation and Invasion by Suppressing COL1A1. Journal of cellular biochemistry. 2018;119:338–46.
Li J, Liu X, Wang W, Li C. miR-133a-3p promotes apoptosis and induces cell cycle arrest by targeting CREB1 in retinoblastoma. Archives of medical science: AMS. 2020;16:941–56.

relativeexpressionofPFKFB3.pzfx

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

MiR-133a-3p Functions as a Tumor Suppressor in Colorectal Cancer by Targeting PFKFB3

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

PFKFB3 is up-regulated in CRC and significantly associated with poor prognosis

PFKFB3 affects CRC cell proliferation and invasion

Low expression of miR-133a-3p has diagnostic value in CRC

miR-133a-3p directly targets PFKFB3

miR-133a-3p Inhibites the Proliferation and Invasion of CRC cells by targeting PFKFB3

Disscussion

Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1