2.1 Cell culture and treatment
Human RCC cell lines Caki-1 and OSRC-2 were bought from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Cells were placed in the RPMI 1640 medium (Thermo Fisher Scientific, MA, USA) containing 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, MA, USA) and 1% penicillin/streptomycin (Invitrogen, CA, USA). The temperature was kept at 37℃, and the concentration of CO2 was 5%. The medium was altered every three days. After trypsinization with 0.25% trypsin (Thermo Fisher Hyclone, Utah, USA), the cells in the logarithmic growth phase were taken for use. For the activating of the TGFBR2-SMAD2/3 pathway, recombinant TGF-β (rTGF-β) (T-7039; Sigma-Aldrich Product Number: MFCD00166089) was used for dealing with RCC cells at 100 ng/ml for 24 hours.
2.2 Cell transfection
Cells in the logarithmic growth stage were trypsinized and inoculated into 6-well plates (5×106/well). After cell growth was stable, Caki-1 and OSRC-2 cells were transfected with miR-19b-3p mimics, miRNA negative control (miR-NC), miR-19b-3p inhibitors (miR-19b-3p-in) and its negative control controls (NC-in), KLF10 overexpression plasmids (KLF10) and blank plasmids (vector) (all provided by Guangzhou Ruibo Biotechnology Co., Ltd) using the FuGENE®HD Transfection Reagent (Roche, Shanghai, China), respectively. Cells in each group were incubated at 37℃ and 5% CO2. After transfection for 24 hours, cells in each group with stable growth were taken for use.
2.3 Construction of Sunitinib resistant cell lines
The drug-resistant cell lines were screened by the combination of high dosage and gradually increasing dosage. After Caki-1 and OSRC-2 cells entered the logarithmic growth phase, the culture medium containing 5 µM Sunitinib was replaced. After 24 hours of culture, the primary medium was replaced by a normal complete medium, and the cells were trypsinized and sub-cultured. When the cells grew to 80% fusion, they were cultured with a 0.5 µM initial concentration. After 48 hours, the primary medium was changed to a normal medium, and the Sunitinib concentration was gradually increased after the cells grew stable. The above procedures were repeated until cells could be grown and sub-cultured stably with 5 µM Sunitinib.
2.4 Cell counting kit-8 (CCK-8) assay
Cells in each group at the logarithmic growth stage were taken, and the cell density was adjusted to 2×103 cells/well after trypsinization. They were then inoculated in 96-well plates. Afterward, 200 µL DMEM medium was added to each well, and the medium was maintained at 37℃ with 5% CO2. When the cells grew to a 50% fusion rate, a new serum-free medium was provided, and the serum was added 24 hours later. After continuous culture for 24 hours, 10 µL CCK-8 solution (Beyotime Biotechnology, Shanghai, China) was added to each well, and the cells’ absorbance values at 450 nm at different periods (12, 24, 36, 48, 60, and 72 hours) were measured according to the CCK-8 instruction.
2.5 Drug sensitivity test
Caki-1 and OSRC-2 cells in the logarithmic phase and their corresponding drug-resistant cell lines (Caki-1R and OSRC-2R) were trypsinized with 0.25% trypsin. After centrifugation at 1500 RPM for 5 min, the cells were seeded in 96-well plates (5×103/well) and maintained in the incubator for 24 hours. After cell adherence, the cells were cultured with Sunitinib at different concentrations (0, 2.5, 5, 10, 10, 20, 40, 80 µM), respectively. Then, 100 µL of the above drugs at different concentrations were added to each well and incubated for 48 hours. At last, cell viability was tested by the CCK-8 method.
2.6 Reverse transcription-polymerase chain reaction (RT-PCR)
The Trizol reagent (Invitrogen, Carlsbad, CA, USA) was adopted to verify the expression of exosomal miR-19b-3p and intracellular KLF10,TGFBR2, BAMBI and ZFYEV9 in Caki-1, OSRC-2, Caki-1R, and OSRC-2R cells, respectively. The PrimeScript™ RT Reagent kit (Invitrogen, Shanghai, China) was applied for reverse transcription of mRNA into cDNA. RT-PCR was then performed with the SYBR GreenPCR reagent and an ABI7500FAST Real-Time PCR instrument. The 2−ΔΔCt method was employed to evaluate the miR-19b-3p, KLF10, TGFBR2༌KLF10༌BAMBI and ZFYVE9 expressions (U6 and GAPDH served as the internal reference). Primer sequences were shown in Table 1.
Table 1
The target
|
Forward (5 '-3')
|
Reverse (5 '-3')
|
miR-19b-3p
|
GTGCAAATCCATGCAAAACTGA
|
GTGCAGGGTCCGAGGTGCT
|
KLF10
TGFBR2
BAMBI
ZFYVE9
|
GGGTGGCTACAGATGTGACT
TCCTTCAAGCAGACCGATGT
CAAAGAGTTGTGGTTCCGGG
AGACCGAAAACAGAGGGGAG
|
CCCGTTGTGCAGAGTTCAAA
AGCACTCAGTCAACGTCTCA
GTCCGTGAAAGCTGTAGTGC
ACATCCATCTGTTCCCTGGG
|
U6
|
CTCGCTTCGGCAGCACA
|
ACGCTTCACGAATTTGCGT
|
GAPDH
|
TGGTTGAGCACAGGGTACTT
|
CCAAGGAGTAAGACCCCTGG
|
2.7 Western blot (WB)
2×106 cells were taken from the above groups, washed with precooled PBS three times, and lysed with RIPA lysate. Then, the supernatant was harvested, and the protein concentration was determined by the BCA method. After polyacrylamide gel electrophoresis, 50 g of the total protein was transferred to polyvinylidene fluoride (PVDF) membranes. After being blocked with 5% skim milk at room temperature (RT) for 2 hours, the membranes were rinsed with 0.05% TBST three times. The membranes were then incubated with the primary antibodies (dilution ratio: 1:1000) provided by Abcam (MA, USA), including Bax (ab32503), Bcl2 (ab218123), Caspase3 (ab13847), CD9 (ab92726), CD63 (ab134045), CD81 (ab109201), TGFβR2 (ab186838), SMAD2 (ab 40855), p-SMAD2 (ab53100), SMAD3 (ab40854), p-SMAD3 (ab52903), KLF10 (ab73537), and β-actin (ab115777) overnight at 4℃. After TBST washing, the membranes were incubated with HRP-labeled rabbit secondary antibody (concentration 1: 3000) for 1 hour. Subsequently, the membranes were cleaned with TBST three times. Finally, the WB reagent (Invitrogen) was applied for color imaging, and each protein’s gray value was analyzed via Image J.
2.8 Isolation and identification of exosomes
Isolation of exosomes by ultracentrifugation: RCC cells Caki-1 and OSRC-2 were placed in a 50 mL centrifuge tube, and 30 mL PBS was added. After centrifugation at a radius of 8 cm and 1500 RPM for 5 min, the cells were cultured in the DMEM/DF12 medium containing 10% fetal bovine serum until cell fusion reached 70%. Then, the medium was changed, and the cells were further cultured for 10 ~ 12 hours. The supernatant was collected in a 2 mL centrifuge tube and processed following the instructions of the RiboTMExosome Isolation Kit (Ribo Biotechnology Co., Ltd., Xi'an, China). Briefly, 2 mL of the sample was transferred to a dry centrifuge tube (2 mL), and one-third of the volume of RibdM Exosome Isolation Reagent B was added and mixed upside down until the sample was completely dissolved. After the mixture was maintained in a refrigerator at 4℃ overnight, it was moved into a new 2 mL centrifuge tube and centrifuged at 1500 RPM for 30 min, and the supernatant was discarded. The remaining substances in the tube were exosomes. Detection of exosomes of RCC by electron microscopy: 2 mL PBS was added into the centrifuge tube for exosome separation and mixed. After 50-fold dilution, 10 µL exosome diluent was collected and added to 2 mm carbon-bearing copper mesh. After standing for 5 min at RT, the excess liquid was blotted off with dry filter paper, and 30 µL of 3% (w/v) sodium phosphotungstate solution was used for re-staining for 30 min and then dried at RT, observed by transmission electron microscopy and photographed. Finally, WB was conducted to detect exosome markers CD9, CD63, and CD81, as described above.
2.10 Colony formation experiment
The cells of each group in the logarithmic growth phase were collected and inoculated in a 100 mm dish containing culture medium at 800 cells per dish, mixed well and incubated. After 24 hours, the primary medium was replaced with the complete medium, and the medium was altered every 3 to 4 days and cultured for 12 days. After PBS washing, 4% paraformaldehyde fixation for 10 min, 5% crystal violet staining for 10 min, the cells were photographed. Image-ProPlus was adopted to calculate the number of cell colony formations in each dish. Each experiment was repeated three times and measured three times.
2.11 Flow cytometry (FCM)
The cells were collected after treatment with the above factors, washed twice with PBS, and resuspended in 150 µL Binding Buffer. Then, 10 µL Annexin V-FITC and 5 µL propidium iodide staining solution (PI) were added to the buffer. The cells were incubated at 4°C for 15 min at RT in the dark. Cell apoptosis was tested following the instructions of the Annexin V-FITC/PI Apoptosis Detection Kit (Yeasen Biotech Co., Ltd.) using FCM.
2.12 Dual-luciferase reporter assay
TGFβR1/R2 was predicted as a potential target of miR-19b-3p by Starbase software, and reporter plasmids of wild-type and mutated TGFBR2 were constructed. MiR-19b-3p mimics and miR-NC were transfected into Caki-1R and OSRC-2R cells. After 48 hours, the luciferase activity was measured according to the dual-luciferase reporter assay instructions (Promega, Madison, WI, USA). We conducted all experiments in triplicate and repeated them three times.
2.13 Xenografted tumor experiment
Sixteen 6-week-old nude mice (body weight: 22-24g, female) were purchased from the Animal Research Center of Wuhan University (license number: SCXK (Chuan) 2018-15) and raised in a specific pathogen-free (SPF) environment with adequate light and air, and free for food and water. All mice used in this experiment were approved by the Animal Ethics committee of Sichuan Provincial People’s Hospital and followed the Guide for the Care and Use of Laboratory Animals. Sixteen mice were randomly divided into 4 groups, with 4 mice in each group. MiR-19b-3p-in and NC-in were transfected into Caki-1R and OSRC-2R cells, respectively, and then the transfected cells (2×106) were injected subcutaneously into the right abdomen of the nude mice. When tumors were observed (with a volume over 10 mm3), they were measured weekly with a vernier caliper, and the tumor volume was calculated. After 5 weeks, the mice were euthanized with phenobarbital (30 mg/kg body weight), dissected about 2 mm from the edge of the tumor, and weighed.
2.14 Immunohistochemistry (IHC)
After paraffin embedding and sectioning (4 µM), the xenografted tumor tissues were dewaxed with xylene and hydrated with gradient alcohol. The endogenous peroxidase was inactivated by 3% H2O2 for 10 min. Microwave repair was performed with 0.01 mol/L sodium citrate buffer (pH = 6.0, 15 min). After blocking for 20 min with 5% bovine serum albumin (BSA), the primary antibodies (1:100) of Ki67 (ab15580), TGFβR2 (ab186838)), p-SMAD2 (ab280888), and p-SMAD3 (ab52903) (all purchased from Abcam, MA, USA) and KLF10 (11881-1-AP) (Proteintech, Chicago, USA), were stored overnight at 4℃. The next day, the goat anti-rabbit secondary antibody was added dropwise and incubated at RT for 20 min. After PBS washing, DAB was utilized for color development. After being re-stained by hematoxylin, dehydrated and transparentized, the sections were mounted and examined microscopically.
2.15 Bioinformatics analysis
MiR-19b-3p level in Kidney Renal Clear Cell Carcinoma and normal tissues was analyzed through Starbase database (http://starbase.sysu.edu.cn/). The survival rate of RCC patients with different levels of miR-19b was analyzed via Kaplan-Meier Plotter (http://kmplot.com/analysis/). The online databases including miRmap, microT, miRanda, Pictar and Targetscan were used for analyzing the potential targets of miR-19b-3p via mirPath v.3 (http://snf-515788.vm.okeanos.grnet.gr/index.php?r=mirpath) was used for analyzing the potential pathways regulated by miR-19b-3p. Venn’s diagram was used for analyzing sharing genes potentially modulated by miR-19b-3p via http://bioinformatics.psb.ugent.be/webtools/Venn/.
2.16 Statistical analysis
In this experiment, SPSS22.0 software was employed to conduct statistics and analysis of all data. All measurement data were expressed as "mean ± standard deviation" (x ± s), and statistical data or percentage (%) were compared using χ2 analysis. One-way variance analysis was used for inter-group comparisons, and the SNK test was employed for multiple group comparisons. P < 0.05 indicated statistical significance.