Bacterial strains, plasmids, enzymes, and chemicals
We purchased F. nucleatum strain ATCC 25586 from American Type Culture Collection (ATCC). The E. coli strains (DH5α, BL21 (DE3), BL21-Condon Plus (DE3) RIL, BL21 (DE3) pLysS, Tuner (DE3), C43 (DE3), Transetta (DE3)), and the plasmid pET-28a were in the preserved state in our laboratory. Also, we purchased the HS DNA polymerase and restriction enzyme from Takara BioEngineering (Dalian, China). DNA gel extraction and plasmid purification kits were purchased from Axygen (corning, America). Chemicals used, such as kanamycin, chloramphenicol, and β-D-1-thiogalactopyranoside (IPTG), were of analytical grade unless otherwise stated.
Bioinformatics Analysis
The complete genome sequence of F. nucleatum ATCC 25586 (NP_603483.1) was obtained in FASTA format from the NCBI database (https://www.ncbi.nlm.nih.gov/). The Stockholm format files from the conserved protein domain family HATPase_c (Pfam02518) of histidine-kinase (HK) and from the conserved domain family Response_reg (Pfam00072) of RR protein was downloaded from the Pfam database (http://pfam.xfam.org/). In HMMER 2.0 software, the command hmmbuild (see Table 1 for commands) was used to construct the hidden Markov models for HATPase_c and Response_reg, which finds out the HKs and RRs with HATPase_c and Response_reg domains. Subsequently, comparing the obtained results with those on the MiST website provides a comprehensive classification of the signal-transduction systems [36]. Finally, we stated three points to determine a pair of two-component signal systems: 1) histidine kinase catalytic domain HATPase_c must be located at the HK C-terminus; 2) the upstream of HATPase_c should have the phosphate receptor domain HisKA; 3) N-terminus of RR should be the phosphate receptor in the target TCSs. Multiple sequence alignments were performed using ClustalX and ESPript [37]. The molecular architecture of the TCS response regulator proteins and ArlR was determined by SMART and Pfam [38]. The structure was predicted from Phyre2 [39].
Construction of the recombinant plasmid
Using the restriction-free (RF) cloning method, we constructed the pET-28a -arlR plasmid. The RF-cloning.org web server was used to design primers F1 (5'– CAGCCATCATCATCATCATCACAGCAGC ATGTTATTATTTTCTTGGGTGAGG – 3', where the sequence in italics represents arlR gene-specific region) and R1 (5' – GGAGCTCGAATTCGGATCCGCG TTAATCCTCTTTATATTGAAATATATAG – 3', where sequence in italics represent the arlR gene-specific region) complementary to insert and vector [40]. The arlR-megaprimers (the first polymerase chain reaction (PCR)) were amplified by PCR, using the primers F1 and R1 from the genomic DNA of strain ATCC 25586 of F. nucleatum. The PCR product was collected by the Axygen Prep DNA Gel Extraction Kit and then inserted into pET-28a plasmid by the secondary PCR reaction (100 ng megaprimers, 200 µM dNTP, 25 ng pET-28a vector, and 1 U HS DNA Polymerase). The collected PCR product was treated with 20 U DpnI and then transformed into the E. coli strain DH 5ɑ using electroporation.
The cytoplasmic domain of histidine kinase (arlSC) was amplified with the primers F2 (5' – CAGCCATCATCATCATCATCACAGCAGC GATAAATTTAAAAATTCACTTG – 3', where sequence in italics represents arlSC gene-specific region) and R2 (5' – GGAGCTCGAATTCGGATCCGCG TTAAAATAGTAGTGTTATTTTTGTTCCC – 3', where sequence in italics represents arlSC gene-specific region). The cloning steps of arlSC were carried out as described above for ArlR.
Expression of the recombinant ArlR
Six different E. coli host strains (BL21 (DE3), BL21-Condon plus (DE3) RIL, BL21 (DE3) pLysS, Tuner (DE3), C43 (DE3), Transetta (DE3)) were used to express ArlR. We selected a positive transformant from each of the host strains and cultured it overnight at 37 °C in 20 mL Luria-Bertani (LB) medium supplemented with the corresponding antibiotics; next, the liquid culture medium was transformed into 50 mL LB medium with 1% culture inoculation and cultivated at 37 °C until the OD600 reached 0.6 – 0.8. Subsequently, the protein expression was induced by the addition of 0.5 mM IPTG at different intervals of time (8 h, 20 h) and temperatures (16 °C, 25 °C). The cells were harvested by centrifugation, resuspended in 1 mL buffer A (20 mM Tris-HCl pH 8.0, 150 mM NaCl), and disrupted by sonication for 5 min on ice. The lysate was then centrifuged at 18,200 × g for 10 min at 4 °C. The soluble and insoluble proteins were detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
Purification of the recombinant protein
The E. coli host strain with the highest protein expression was selected for large-scale protein expression through the subsequent purification steps. Five grams of wet cells, harvested by centrifugation, were resuspended in 35 mL of buffer A. Aliquots of 1 mL were taken from the 35 mL resuspended buffer. Each aliquot was centrifuged for precipitation. Cells were resuspended in buffer A containing different additives (5% glycerol, 50 mM L-Arg, 50 mM betaine, 1% Triton X-100, 50 mM L-Arg and 50 mM L-Glu) separately and, respectively. The cells were then disrupted by sonication and analyzed by 15% SDS-PAGE, which revealed buffer A with 5% glycerol to be the most suitable buffer. The crude extracts were precipitated by centrifugation at 18,200 × g for 45 min at 4 °C. The soluble supernatant of the lysate was mixed with 5 mL Ni-NTA affinity resin (GE Healthcare, USA), and the solution was incubated for 30 min in a rotating shaker at 4 °C. We further loaded the resulting slurry onto a 50 mL column, where the resin was washed away with buffer B (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5% glycerol, 20 mM imidazole). The target protein was eluted from the column by buffer C (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5% glycerol, 250 mM imidazole). The eluted protein was concentrated and loaded onto the HiLoad Superdex 200 26/60 column (GE Healthcare, USA) and was equilibrated with buffer A containing 5% glycerol. We used 15% SDS-PAGE and Coomassie staining to analyze the samples obtained from each purification step. The expression and purification of ArlSC were carried out as described above for ArlR.
Circular dichroism spectroscopy
Circular dichroism (CD) spectroscopy was performed on a ChirascanTM spectrometer (Applied Photophysics Ltd) with a 0.1 cm path length of the quartz cuvette. The samples were prepared using buffer A (20 mM Tris-HCl, pH 8.0, 150 mM NaCl) and 0.2 mg/mL ArlR. The sample was 200 µL with 1 nm bandwidth length, 185 – 260 nm scanning range, and 0.5 s time-per-point. The spectrum of the target protein at 191 – 260 nm was obtained over a range of temperatures starting from 20 °C and incrementally increasing to 94 °C, which we used to measure the ArlR melting temperature (Tm). Ultimately, the Tm value was calculated by the Global 3 software, while the secondary structure was visualized and analyzed using the Deconvolution software that comes with the instrument.
Autophosphorylation and phosphoryl transfer assays
Purified ArlSC was pre-equilibrated with the phosphorylation buffer (20 mM Tris-HCl at pH 8.0, 50 mM KCl, 5 mM MgCl2) in a final volume of 100 µL. Subsequently, an autophosphorylation reaction was initiated by adding the aliquots of ATP to a final concentration of 10 µM and lasting for 30 min at 25 °C. The intrinsic kinase activity of ArlSC was measured using the Promega Kinase-Glo Luminescent Kinase Assay Kit. As for the phosphoryl transfer assays, the purified ArlR was added to the phosphorylated ArlSC to initiate phosphotransfer reaction in the phosphorylation buffer with 10 µM ATP for 10 min at 25 °C. Lastly, the persistent ATP was measured by the Promega Kinase-Glo Luminescent Kit.
Microscale thermophoresis (MST) assay
As previously reported [41], the affinity of ArlR and ArlSC was determined by MST using Monolith NT.115 (NanoTemper Technologies, Germany). Briefly, ArlSC was labeled with NHS fluorescent dye and centrifuged at 18,200 ´ g for 10 min to eliminate precipitation. A 16 step 1:1 (v/v) ArlR serial stock, with twofold dilution, was prepared with the MST buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 10 mM MgCl2, 0.05% Tween-20), such that each dilution step reduced the protein concentration by 50%. Equal volumes of the labeled ArlSC and unlabeled ArlR were mixed, incubated for 5 min at room temperature, and added to capillaries for measurement. The data were analyzed using NanoTemper Analysis software.
According to the protocol as described previously [42], the binding of ArlR to its promoter was determined by MST using Monolith NT.115 (NanoTemper Technologies, Germany).Briefly, the promoter of ArlR was amplified with primers of F2 (Cy5 – 5' – CCTCACCCAAGAAAATAATAATAAC – 3') and R2 (5' – CCAAATAAGGCATAAGAGAGC – 3'). A 16 step 1:1 (v/v) serial ArlR stock, with twofold dilution, was prepared with the MST buffer (50 mM Tris-HCl at pH 8.0, 150 mM NaCl, 10 mM MgCl2, 0.05% Tween-20). Equal volumes of the labeled DNA and unlabeled protein solutions were mixed and incubated for 5 min at room temperature. Lastly, the samples were loaded into silica capillaries and measured by MST instrument.