Patients and specimens
Tissue samples from 105 patients diagnosed with NSCLC between 2013 and 2015, and corresponding clinicopathological information, were acquired from the Pathology Department of the First Affiliated Hospital of China Medical University. All tumors were collected through curative surgical resection. None of the enrolled patients had received pre-surgical chemotherapy or radiation. Among the 105 tissue samples, 81 were paraffin-embedded tissues that were used for immunohistochemistry analysis, whereas 24 tissues were fresh samples, of which eight and 16 samples were used for western blotting and real-time polymerase chain reaction (RT-PCR) analyses, respectively. All patients were included in the study retrospectively and randomly. The study was approved by the Medical Research Ethics Committee of the First Affiliated Hospital of China Medical University (KLS [2020] No. 2020-40-2, Shenyang China). The requirement for informed consent was waivered considering the retrospective nature of the study. All 81 patients whose samples were used for immunohistochemistry analysis were followed up for at least 3 years.
Cell lines and cell culture
The human bronchial epithelial (HBE) cell line was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). The other cell lines (A549, H460, H1299, H1975, H226, H661, 293T, and SK-MES-1) used were purchased from the Shanghai Cell Bank (Shanghai, China). A549, H1299, H460, H661, H226, and H1975 cells were cultured in RPMI-1640 medium, SK-MES-1 cells were cultured in minimal essential medium, and HBE and 293T cells were cultured in Dulbecco's modified Eagle’s medium. Except for the media used for the H1975 cell line, all other media were supplemented with 10% fetal bovine serum (FBS). The media for the H1975 cell line was supplemented with 20% FBS. All media were purchased from Gibco (Waltham, MA, USA); FBS was purchased from Clark Bioscience (Webster, TX, USA).
Immunohistochemistry (IHC)
As described previously [19], tissue sections were probed with appropriate primary antibodies (Additional file 1). Staining intensity was scored as follows: 0 (no staining), 1 (weak), 2 (moderate), or 3 (high). Percentage scores were assigned as follows: 1 (0–25%), 2 (26–50%), 3 (51–75%), and 4 (76–100%). The final score for each specimen (0−12) was calculated by multiplying the intensity score with the percentage score. Tumor tissues with scores > 6 were considered to have positive expression, whereas those with scores ≤ 6 were considered to have negative expression.
Cell treatment and transfection
TSPAN3- and RAB11a-specific siRNAs and scrambled control siRNAs were purchased from RiboBio (Guangzhou, China). The pCMV6-Myc-FLAG-TSPAN3 construct (#RC203876) and the empty vector were purchased from OriGene (Rockville, MD, USA). The pCMV6-GFP-TSPAN3-ΔLEL construct containing a splice variant (LEL deletion) of wild-type TSPAN3 was purchased from TSINGKE Biological Technology (Beijing, China). Lipofectamine 3000 (Invitrogen, Waltham, MA, USA) was used for transfection according to the manufacturer’s instructions.
Nocodazole (NZ) washout was performed to explore β1 integrin trafficking as previously described [20]. After 12 h of serum starvation, A549 cells were treated with NZ (10 µM; #31430-18-9; MedChemExpress, Monmouth Junction, NJ, USA) for 4 h to completely depolymerize the microtubules (MTs). Then, the drug was washed off with serum-free medium to allow MT repolymerization at different intervals after NZ washout.
For fibronectin (FN) stimulation of cells, recombinant human FN (10 μg/mL; #1918-FN-02M; R&D Systems, Minneapolis, MN, USA) was added to RPMI-1640 medium supplemented with 1% FBS.
Western blotting
Whole-cell lysates were prepared from cells and tumor tissues using the NP-40 lysis buffer (P0013F, Beyotime Biotechnology, Shanghai, China) containing PMSF (1:100, ST506; Beyotime Biotechnology) and phosphatase inhibitor (1:100; B15002; Biotool, Shanghai, China). Total protein was quantified using the Bradford method, and proteins were resolved with 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis with the loading amount of 60 µg and transferred onto polyvinylidene difluoride membranes (Millipore, Burlington, MA, USA). The membranes were then probed overnight with the appropriate primary antibodies at 4 °C (Additional files 1 and 2), washed three times with tris-buffered saline and Tween 20 (TBST) buffer, and incubated with horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies (1:2000; Proteintech) at about 22 °C for 2 h. Protein bands were visualized via enhanced chemiluminescence (H34080; Thermo Fisher Scientific) using a BioImaging System (UVP, Upland, CA, USA). Relative expression was analyzed using ImageJ (National Institutes of Health, Washington, DC, USA); the expression of target proteins was normalized against that of GAPDH or β-actin.
Quantitative RT-PCR
Total RNA of cells and tissues were extracted as described previously [21]. Quantitative RT-PCR was carried out in a 7900HT Fast Real-time PCR System (Applied Biosystems, Foster City, CA, USA) using SYBR Premix Ex Taq II (RR820A, Takara Bio, Beijing, China) in a total volume of 20 μL according to the manufacturer’s instructions. Relative gene expression was calculated by the 2−ΔΔCt method; the β-actin-encoding gene was used as the reference. The primer sequences used are listed as follows. All experiments were performed in triplicate.
TSPAN3 forward, 5′–ATGGAACCAACCCTGATGCTGCTAG–3′;
TSPAN3 reverse, 5′–AGTCTCTCTGCAGCAGCTAAGAGGG–3′;
β1 integrin forward: 5′–CAAGAGAGCTGAAGACTATCCCA-3′;
β1 integrin reverse: 5′-TGAAGTCCGAAGTAATCCTCCT–3′;
β-actin forward: 5′–ATAGCACAGCCTGGATAGCAACGTAC-3′;
β-actin reverse: 5′–CACCTTCTACAATGAGCTGCGTGTG–3′.
Cell proliferation assay
Cells transfected with the TSPAN3-expressing plasmid or empty vector were seeded (3000 cells/well) in 96-well plates for MTS cell proliferation assay. Absorbance at 450 nm was detected every 24 h. A growth curve was generated using the absorbance values after culture for 4 days.
Colony formation assay
Cells transfected with TSPAN3-expressing plasmid or empty vector were seeded (500 cells/well) in 6-well plates and cultured until the formation of visible colonies. Images were acquired on a BioImaging System (DNR, Neve Yamin, Israel). All experiments were performed at least three times.
Co-immunoprecipitation and mass spectrometric assay
Assays were performed as previously described [22].
Immunofluorescence
The A549 and H460 cells (2 × 105) were seeded in 24-well plates and cultured for 24 h, fixed with 4% paraformaldehyde for 10 min, blocked with 5% bovine serum albumin for 2 h, and then probed overnight with the appropriate primary antibodies at 4 °C (Additional file 1). After washing 3 times with PBS, the cells were incubated with TRITC-conjugated or FITC-conjugated secondary antibodies at approximately 22 °C for 2 h, and the nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; C1005, Beyotime Biotechnology). Images were captured using an Olympus FV3000 laser-scanning confocal microscope (Olympus, Tokyo, Japan).
For quantification of β1 integrin and Rab11a colocalization, the Pearson correlation coefficient was analyzed using the Fluoview software (FV31S-SW, Olympus, Tokyo, Japan).
Flow cytometry
A549 cells collected via trypsinization at different time points after NZ washout were washed with cold PBS. Resultant cells (1 × 105 cells/sample) were stained with PE-conjugated β1 integrin antibody (1:100; #12-0299-42; eBioscience, San Diego, CA, USA) at 4 °C for 20 min. The samples were washed three times to remove unbound antibodies and fixed with cold 4% paraformaldehyde for 20 min. The mean fluorescence intensity of each sample was measured using a FACScan flow cytometer (BD, Franklin Lakes, NJ, USA).
Tumor formation in nude mice
Nude mice used in this study were treated following the experimental animal ethics guidelines issued by the China Medical University. Four-week-old female BALB/c nude mice were purchased from Slac (Shanghai, China) and were maintained in a laminar-flow cabinet under specific pathogen-free conditions for one week before use. Each mouse was inoculated subcutaneously in the right axilla with 1 × 107 tumor cells (selected by G418) in 0.2 mL sterile phosphate-buffered saline. Four weeks after axilla inoculation, the mice were euthanized, and necropsies were performed to examine tumor growth.
Statistical analyses
The relationships between TSPAN3 expression and clinicopathological factors and d β1 integrin were statistically analyzed and tested using the chi-squared test. The association between TSPAN3 expression and the prognosis of NSCLC patients was analyzed using both Kaplan–Meier and Cox proportional hazards models. All statistical analyses were performed using the SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). Differences between two groups were analyzed using a paired Student's t-test using Prism 6.0 (GraphPad Software, San Diego, CA, USA). P-values < 0.05 were considered significant.