Human studies
Primary AML patient specimens are from Toulouse University Hospital (TUH), Toulouse, France]. Frozen samples were obtained from patients diagnosed with AML at TUH after signed informed consent in accordance with the Declaration of Helsinki, and stored at the HIMIP collection (BB-0033-00060). According to the French law, HIMIP biobank collection has been declared to the Ministry of Higher Education and Research (DC 2008-307, collection 1) and obtained a transfer agreement (AC 2008-129) after approbation by the Comité de Protection des Personnes Sud-Ouest et Outremer II (ethical committee). Clinical and biological annotations of the samples have been declared to the CNIL (Comité National Informatique et Libertés ie Data processing and Liberties National Committee). See Table S5 for age, sex, cytogenetics and mutation information on human specimens used in the current study.
In vivo animal studies
NSG (NOD.Cg-Prkdcscid Il2rgtm1WjI/SzJ) mice (Charles River Laboratories) were used for transplantation of AML cell lines or primary AML samples. Male or Female mice ranging in age from 6 to 9 weeks were started on experiment and before cell injection or drug treatments, mice were randomly assigned to experimental groups. Mice were housed in sterile conditions using HEPA-filtered micro-isolators and fed with irradiated food and sterile water in the Animal core facility of the Cancer Research Center of Toulouse (France). All animals were used in accordance with a protocol reviewed and approved by the Institutional Animal Care and Use Committee of Région Midi-Pyrénées (France).
Cell lines, primary cultures, Culture Conditions
For primary human AML cells, peripheral blood or bone marrow samples were frozen in FCS with 10% DMSO and stored in liquid nitrogen. The percentage of blasts was determined by flow cytometry and morphologic characteristics before purification. Cells were thawed in 37°C water bath, washed in thawing media composed of IMDM, 20% FBS. Then cells were maintained in IMDM, 20% FBS and 1% Pen/Strep (GIBCO) for all experiments.
Human AML cell lines were maintained in RPMI-media (Gibco) supplemented with 10% FBS (Invitrogen) in the presence of 100 U/mL of penicillin and 100μg/mL of streptomycin, and were incubated at 37°C with 5% CO2. The cultured cells were split every 2 to 3 days and maintained in an exponential growth phase. All AML cell lines were purchased at DSMZ or ATCC, and their liquid nitrogen stock were renewed every 2 years. These cell lines have been routinely tested for Mycoplasma contamination in the laboratory. The U937 cells were obtained from the DSMZ in February 2012 and from the ATCC in January 2014. MV4-11 and HL-60 cells were obtained from the DSMZ in February 2012 and 2016. KG1 cells were obtained from the DSMZ in February 2012 and from the ATCC in March 2013. KG1a cells were obtained from the DSMZ in February 2016. MOLM14 was obtained from Pr. Martin Carroll (University of Pennsylvania, Philadelphia, PA) in 2011.
Mouse Xenograft Model
NSG mice were produced at the Genotoul Anexplo platform at Toulouse (France) using breeders obtained from Charles River Laboratories. Transplanted mice were treated with antibiotic (Baytril) for the duration of the experiment. For experiments assessing the response to chemotherapy in PDX models, mice (6–9 weeks old) were sublethally treated with busulfan (30 mg/kg) 24 hours before injection of leukemic cells. Leukemia samples were thawed in 37°C water bath, washed in IMDM 20% FBS, and suspended in Hank’s Balanced Salt Solution at a final concentration of 1–10×106 cells per 200 μL for tail vein injection in NSG mice. Eight to 18 weeks after AML cell transplantation and when mice were engrafted (tested by flow cytometry on peripheral blood or bone marrow aspirates), NSG mice were treated by daily intraperitoneal injection of 60 mg/kg AraC or vehicle (PBS) for 5 days. AraC was kindly provided by the pharmacy of the TUH. Mice were sacrificed at day 8 to harvest human leukemic cells from murine bone marrow. For AML cell lines, mice were treated with busulfan 20mg/kg) 24 hours before injection of leukemic cells. Then cells were thawed and washed as previously described, suspended in HBSS at a final concentration of 2×106 per 200 μL before injection into bloodstream of NSG mice. For experiments using inducible shRNAs, doxycycline (0.2 mg/ml + 1% sucrose; Sigma-Aldrich, Cat# D9891) was added to drinking water the day of cell injection or 10 days after until the end of the experiment. Mice were treated by daily intraperitoneal injection of 30 mg/kg AraC for 5 days and sacrificed at day 8. Daily monitoring of mice for symptoms of disease (ruffled coat, hunched back, weakness, and reduced mobility) determined the time of killing for injected animals with signs of distress.
Assessment of Leukemic Engraftment
At the end of experiment, NSG mice were humanely killed in accordance with European ethics protocols. Bone marrow (mixed from tibias and femurs) and spleen were dissected and flushed in HBSS with 1% FBS. MNCs from bone marrow, and spleen were labeled with anti-hCD33, anti-mCD45.1, anti-hCD45, anti-hCD3 and/or anti-hCD44 (all from BD) antibodies to determine the fraction of viable human blasts (hCD3-hCD45+mCD45.1−hCD33+/hCD44+AnnV- cells) using flow cytometry. In some experiments, we also added anti-CALCRL, anti-CD34 and anti-CD38 to characterize AML stem cells. Monoclonal antibody recognizing extracellular domain of CALCRL was generated in the lab with the help of Biotem company (France). Then antibody was labelled with R-Phycoerythrin using Lightning-Link kit (Expedeon). All antibodies were used at concentrations between 1/50 and 1/200 depending on specificity and cell density. Acquisitions were performed on a LSRFortessa flow cytometer with DIVA software (BD Biosciences) or CytoFLEX flow cytometer with CytoExpert software (Beckman Coulter), and analyses with Flowjo. The number of AML cells/μL peripheral blood and number of AML cells in total leukemia burden (in bone marrow and spleen) were determined by using CountBright beads (Invitrogen) using described protocol.
For LDA experiments, human engraftment was considered positive if at least >0.1% of cells in the murine bone marrow were hCD45+mCD45.1−hCD33+. The cut-off was increased to >0.5% for AML#31 because the engraftment was measured only based on hCD45+mCD45.1−. Limiting dilution analysis was performed using L-calc software. List of antibodies used in this work: Anti-CALCRL (Jean-Emmanuel Sarry lab), Anti-mCD45.1 PERCPCY5.5 (BD, Cat# 560580), Anti-hCD45 APC (BD, Cat# 555485), Anti-hCD34 AF700 (BD, Cat# 561440), Anti-hCD38 PECY7 (BD, Cat# 335825), Anti-hCD33 PE (BD, Cat# 555450), Anti-hCD44 BV421 (BD, Cat# 562890).
Immunochemistry analysis
Protein expression was investigated by immunoreactivity scoring on tissue microarrays containing pretherapeutic bone marrow samples from intensively treated AML patients. Studies on the tissue microarray have been approved by the institutional review board of the University of Münster. Detailed information on the AML tissue microarray cohort and CALCRL expression has been published previously.1 AML tissue microarrays were stained using an anti-ADM (Abcam, ab69117) antibody as described.2 Briefly, following deparaffinization and heat-induced epitope unmasking, 4 µm tissue sections were incubated with the primary antibodies, followed by suitable secondary and tertiary antibodies (Dako). Immunoreactions were visualized with a monoclonal APAAP-complex and a fuchsin-based substrate-chromogen system (Dako). Counterstaining was performed with Mayer’s hemalum (Merck). Two investigators who were blinded towards patient characteristics and outcome independently assessed intensity of staining (1 = no/weak, 2 = moderate, 3 = strong staining intensity) and percentage of stained blasts at each intensity level. Subsequently, H-scores were calculated as described [H-score = 1 x (percentage of blasts positive at 1) + 2 x (percentage of blasts positive at 2) + 3 x (percentage of blasts positive at 3)].1 There was a good inter-investigator agreement (r = .91 for ADM, p < .0001). Samples from 179 AML patients were evaluable for CALCRL and ADM. Images were taken using a Nikon Eclipse 50i microscope equipped with a Nikon DS-2Mv.
1Angenendt et al, Leukemia 2019. (DOI: 10.1038/s41375-019-0505-x)
2Angenendt et al, Leukemia 2018. (DOI: 10.1038/leu.2017.208)
Western blot analysis
Proteins were resolved using 4% to 12% polyacrylamide gel electrophoresis Bis-Tris gels (Life Technology, Carlsbad, CA) and electrotransferred to nitrocellulose membranes. After blocking in Tris-buffered saline (TBS) 0.1%, Tween 20%, 5% bovine serum albumin, membranes were immunostained overnight with appropriate primary antibodies followed by incubation with secondary antibodies conjugated to HRP. Immunoreactive bands were visualized by enhanced chemiluminescence (ECL Supersignal West Pico; Thermo Fisher Scientific) with a Syngene camera. Quantification of chemiluminescent signals was done with the GeneTools software from Syngene. List of antibodies used in this work: anti-CASPASE-3 (CST, Cat#9662), Anti-ACTIN (Millipore, Cat# MAB1501), anti-CALCRL (Elabscience, Cat# ESAP13421), anti-RAD51 (Abcam, Cat# ab133534), anti-BCL2 (CST, Cat# 2872), anti-E2F1 (C-20) (Santa Cruz, Cat# sc-193), anti-CHK1 (Santa Cruz, Cat# sc-8408), anti-RAMP1 (3B9) (Santa Cruz, Cat# sc-293438), anti-RAMP2 (B-5) (Santa Cruz, Cat# sc-365240), anti-RAMP3 (G-1) (Santa Cruz, Cat# sc-365313), anti-ADM (Thermo Fisher Scientific, Cat# PA5-24927), anti-CGRP (Abcam, Cat# ab47027), anti-PARP (Thermo Fisher Scientific, Cat# 44-698G), anti-alpha/beta-Tubulin (CST, Cat# 2148).
Cell death assay
After treatment, 5.105 cells were washed with PBS and resuspended in 200μL of Annexin-V binding buffer (BD, Cat# 556420). Two microliters of Annexin-V-FITC (BD, Cat# 556454) and 7-amino-actinomycin D (7-AAD; Sigma Aldrich) were added for 15 minutes at room temperature in the dark. All samples were analyzed using LSRFortessa or CytoFLEX flow cytometer.
Cell cycle analysis
Cells were harvested, washed with PBS and fixed in ice-cold 70% ethanol at −20°C. Cells were then permeabilized with 1×PBS containing 0.25% Triton X-100, resuspended in 1×PBS containing 10 µg/ml propidium iodide and 1 µg/ml RNase, and incubated for 30 min at 37°C. Data were collected on a CytoFLEX flow cytometer.
Clonogenic assay
Primary cells from AML patients were thawed and resuspended in 100μl Nucleofector Kit V (Amaxa, Cologne, Germany). Then, cells were nucleofected according to the manufacturer's instructions (program U-001 Amaxa, Cologne, Germany) with 200nM siRNA scrambled (ON-TARGETplus Non-targeting siRNA #2, Dharmacon) or anti-CALCRL (SMARTpool ON-TARGETplus CALCRL siRNA, Dharmacon). Cells were adjusted to 1×105 cells/ml final concentration in H4230 methylcellulose medium (STEMCELL Technologies) supplemented with 10% 5637-CM as a stimulant and then plated in 35-mm petri dishes in duplicate and allowed to grow for 7 days in a humidified CO2 incubator (5% CO2, 37°C). At day 7, the leukemic colonies (more than five cells) were scored.
Plasmid cloning, shRNA, lentiviral production and leukemic cell transduction
shRNA sequences were constructed into pLKO-TET-ON or bought cloned into pLKO vectors. Each construct (6 μg) was co-transfected using lipofectamine 2000 (20 μL) in 10cm-dish with psPax2 (4 μg, provides packaging proteins) and pMD2.G (2 μg, provides VSV-g envelope protein) plasmids into 293T cells to produce lentiviral particles. Twenty-four hours after cell transfection, medium was removed and 10ml opti-MEM+1% Pen/Strep was added. At about 72 hours post transfection, 293T culture supernatants containing lentiviral particles were harvested, filtered, aliquoted and stored in -80°C freezer for future use. At the day of transduction, cells were infected by mixing 2.106 cells in 2ml of freshly thawed lentivirus and Polybrene (Sigma-Aldrich, Cat# 107689) at a final concentration of 8 ug/ml. At 3 days post infection, transduced cells were selected using 1 μg/ml puromycin. List of plasmids used in this work: pCDH-puro-Bcl2 (Cheng et al., Addgene plasmid #46971), Tet-pLKO-puro (Wiederschain et al., Addgene plasmid #21915), CALCRL MISSION shRNA (shCALCRL#1, Sigma-Aldrich, Cat# TRCN0000356798; shCALCRL#2, Sigma-Aldrich, Cat# TRCN0000356736), E2F1 MISSION shRNA (Sigma-Aldrich, Cat# TRCN0000039659). List of shRNA sequences: shCALCRL#1 FW CTTATCTCGCTTGGCATATTC, shCALCRL#2 FW TTACCTGATGGGCTGTAATTA, shE2F1 FW CGCTATGAGACCTCACTGAAT, shRAMP1 FWCCCTTCTTCCAGCCAAGAAGA, shRAMP2 FW GAGCTTCTCAACAACCATGTT, shRAMP3 FW GGACTAGGACTCCTTGCTTGA .
IC50 experiments
The day before experiment, cells were adjusted to 3×105 cells/ml final concentration and plated in a 96-well plate (final volume: 100μl). To measure half-maximal inhibitory concentration (IC50), increased concentrations of AraC or idarubicin were added to the medium. After two days, 20 μl per well of MTS solution (Promega) was added for two hours and then absorbance was recorded at 490nm with a 96-well plate reader. The doses that decrease cell viability to 50% (IC50) were analyzed using nonlinear regression log (inhibitor) vs. response (three parameters) with GraphPad Prism software.
Measurement of oxygen consumption in AML cultured cells using Seahorse Assay
All XF assays were performed using the XFp Extracellular Flux Analyser (Seahorse Bioscience, North Billerica, MA). The day before the assay, the sensor cartridge was placed into the calibration buffer medium supplied by Seahorse Biosciences to hydrate overnight. Seahorse XFp microplates wells were coated with 50 µl of Cell-Tak (Corning; Cat#354240) solution at a concentration of 22.4 µg/ml and kept at 4°C overnight. Then, Cell-Tak coated Seahorse microplates wells were rinsed with distillated water and AML cells were plated at a density of 105 cells per well with XF base minimal DMEM media containing 11 mM glucose, 1 mM pyruvate and 2 mM glutamine. Then, 180 µl of XF base minimal DMEM medium was placed into each well and the microplate was centrifuged at 80 g for 5 min. After one hour incubation at 37°C in CO2 free-atmosphere, basal oxygen consumption rate (OCR, as a mitochondrial respiration indicator) and extracellular acidification rate (ECAR, as a glycolysis indicator) were performed using the XFp analyzer.
Alkalin Comet assays
Alkalin Comet assays were performed with OxiSelect Comet Assay Kit and according to the manufacturer's instructions (Cell Biolabs Inc.). Electrophoresis was performed at 4°C in alkaline condition at 20V during 45mn. Slides were visualized by using a fluorescence microscope (AxioObserver Z1; Zeiss). Comet tail moments were measured with ImageJ software (version 1.8v) with the plugin OpenComet (http://opencomet.org/). Apoptotic cells were excluded from the analysis.
RNA microarray and bioinformatics analyses
For primary AML samples, human CD45+CD33+ were isolated using cell sorter cytometer from engrafted BM mice (for 3 primary AML specimens) treated with PBS or treated with AraC. RNA from AML cells was extracted using Trizol (Invitrogen) or RNeasy (Qiagen). For MOLM-14 AML cell line, mRNA from 2.106 of cells was extracted using RNeasy (Qiagen). RNA purity was monitored with NanoDrop 1ND-1000 spectrophotometer and RNA quality was assessed through Agilent 2100 Bionalyzer with RNA 6000 Nano assay kit. No RNA degradation or contamination were detected (RIN > 9). 100 ng of total RNA were analysed on Affymetrix GeneChip© Human Gene 2.0 ST Array using the Affymetrix GeneChip© WT Plus Reagent Kit according to the manufacturer’s instructions (Manual Target Preparation for GeneChip® Whole Transcript (WT) Expression Arrays P/N 703174 Rev. 2). Arrays were washed and scanned; and the raw files generated by the scanner was transferred into R software for preprocessing (with RMA function, Oligo package), quality control (boxplot, clustering and PCA) and differential expression analysis (with eBayes function, LIMMA package). Prior to differential expression analysis, all transcript clusters without any gene association were removed. Mapping between transcript clusters and genes were done using annotation provided by Affymetrix (HuGene-2_0-st-v1.na36.hg19.transcript.csv) and the R/Bioconductor package hugene20sttranscriptcluster.db. p-values generated by the eBayes function were adjusted to control false discovery using the Benajmin and Hochberg’s procedure. [RMA] Irizarry et al., Biostatistics, 2003; [Oligo package] Carvalho and Irizarry, Bioinformatics, 2010; [LIMMA reference] Ritchie et al., Nucleic Acids Research, 2015; hugene20sttranscriptcluster.db :MacDonald JW 2017, Affymetrix hugene20 annotation data (chip hugene20sttranscriptcluster); [FDR]: Benjamini et al., Journal of the Royal Statistical Society, 1995.
GSEA analysis
GSEA analysis was performed using GSEA version 3.0 (Broad Institute). Gene signatures used in this study were from Broad Institute database, literature, or in-house built. Following parameters were used: Number of permutations = 1000, permutation type = gene_set. Other parameters were left at default values.
Statistical analysis
We assessed the statistical analysis of the difference between two sets of data using two-tailed (non-directional) Student’s t test with Welch’s correction. For survival analyses, we used Log-rank (Mantel-Cox) test. Analyses were performed using Graphpad Prism (V6 and V8). For Limiting Dilution Assay experiments, frequency and statistics analyses were performed using L-calc software (Stemcell technologies). A p value of less than 0.05 indicates significance. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, not significant. Detailed information of each test is in the figure legends.