Antibodies and reagents
The main antibody information was listed below: LSD1 (CST, cat# 2139), H3 (CST, cat# 4499), H3K4me (CST, cat# 5326), H3K4me2 (CST, cat# 9725), H3K9me (CST, cat# 14186), H3K9me2 (CST, cat# 4658), phospho-p53 (Ser 15,CST, cat# 9284), phospho-mTOR (Ser 2448, CST, cat# 5536), p70 S6K (CST, cat# 2708), phospho-p70 S6k (Thr 421/Ser 424, CST, cat# 9204), phospho-S6 (CST, Ser235/236, cat#2211), Beclin-1 (CST, cat# 3495), Bax (CST, cat# 2772), Cleaved Caspase-3 (CST, cat# 9664), GAPDH (CST, cat# 2118), Ki67 (Abcam, cat# ab16667), mTOR (ZEN BIO, cat# 380411), p53 (Proteintech, cat# 10442-1-AP), Caspase-8 (Proteintech, cat# 13434-1-AP), CDK4 (Proteintech, cat# 11026-1-AP), CDK6 (Proteintech, cat# 14052-1-AP), Cyclin D1 (Proteintech, cat# 60186-1-AP), LC3B (Santa Cruz, sc-376404), p62/SQSTM1 (HUA BIO, cat# R1309-8), S6 (Abclonel, cat# A6058), PCNA (Gservice, Gb13030-2).
GSK2879552, 3MA, chloroquine (CQ) and Z-VAD-FAM were purchased from Selleckchem (TX, USA). ZY0511 was synthesized in laboratory as described previously [9].
Cell Lines and cell culture
The human DLBCL cell lines including SU-DHL-4, SU-DHL-6, SU-DHL-10 and Farage were purchased from American Type Culture Collection (ATCC, VA, USA). The DLBCL cells were cultured in RPMI 1640 medium containing 20% fetal bovine serum (Gibco), at 37°C and 5% CO2.
Western blot
The human DLBCL cells were lysed with RIPA lysis buffer containing protease inhibitor and phosphatase inhibitors. Next, the BCA (bicinchoninic acid) method was used to quantify the protein concentrations. Proteins were isolated by SDS-PAGE gel, and then transferred onto polyvinylidene fluoride membranes (Millipore). After blocking with 5% skimmed milk, the membranes were incubated with the specific antibodies at 4°C overnight. Washed the membranes with TBST buffer three times and incubated with HRP conjugated secondary antibodies at room temperature for 1 h. At last, the protein levels were visualized using Chemiluminescent HRP Substrate (Millipore) and signals were detected using chemiluminescence imaging system.
Cellular thermal shift assay (CETSA)
The DLBCL cells were seeded (2 × 105 cells/mL) and treated with DMSO or ZY0511 at the final concentration of 200 μM at 37°C for 1 h. The cells were harvested and then washed with pre-chilled PBS for twice, followed by resuspension in pre-chilled PBS containing protease inhibitor. The cell suspension were aliquoted into PCR tubes (1.5×106 cells/tube) and heated at different temperatures (42°C, 44°C, 46°C, 48°C, 50°C, 52°C, 54°C) for 3 min, followed by placed at room temperature for 3 min. Next, the sample was subjected to three freeze (in liquid nitrogen) - thaw cycles (at room temperature), and the supernatant was obtained by centrifugation at 20000 × g for 20 min at 4°C. Subsequently, loading buffer was added, and then proteins were denatured at 100°C for 10 min. Finally, the level of LSD1 was detected by western blot assay. Western blot signals based on densitometry method were quantified by Fiji and CETSA curves in intact cells were graphed by GraphPad Prism 8 software (San Diego, USA).
Cell proliferation inhibition determined by the AO/PI (Acridine Orange/ Propidium Iodide) method
The DLBCL cells were seeded (2 × 105 cells/mL) and treated with ZY0511 (2 μM) and/or Z-VAD-FMK (50 μM) for 48 h. The cell number and viability were determined by an AO/PI exclusion test. The results were plotted as means ± SEM of three separate experiments.
MTT assay
An MTT (Sigma, USA) experiment was conducted to assess the proliferation inhibitory rate of ZY0511 against DLBCL cells. The DLBCL cells were treated with various concentrations of ZY0511 in 96-well plates for 24 h (8 × 104 cells/well), 48 h (4 × 104 cells/well), 72 h (2 × 104 cells/well) and 96 h (1 × 104 cells/well), respectively. Then, 20 μL MTT (5 mg/mL) was added to form formazan. Optical density was measured using a microplate reader (Thermo Fisher Scientific, USA). The IC50 values were calculated by GraphPad Prism 8 software using XY modeling.
EdU incorporation assay
The DLBCL cells were seeded (2 × 105 cells/mL) and treated with ZY0511 at the final concentrations of 0.5, 1, 2 μM for 24 h. The DLBCL cells were grown in medium containing EdU, which is a thymidine analogue labelled cells in the proliferation phase for 2 h. Then, the EdU positive cells were stained with Cell-Light EdU Apollo488 In Vitro Flow Cytometry Kit according to Ribobo’s instructions (Shanghai, China). Cells were measured by flow cytometry (FCM) (Agilent NovoCyte, San Diego, USA) and analyzed using NovoExpress software (Agilent NovoCyte, San Diego, USA).
Cell cycle analysis
The DLBCL cells were seeded (2 × 105 cells/mL) and treated with ZY0511 at the final concentrations of 0.5, 1, 2 μM for 24 h. Then, the DLBCL cells were collected and fixed with 70% ethanol solution at 4℃ overnight. Fixed cells were stained with propidium iodide according to KeyGEN BioTECH’s instructions (Jiangsu, China). Cells were measured by FCM (Agilent NovoCyte, San Diego, USA) and analyzed using NovoExpress software (Agilent NovoCyte, San Diego, USA).
Apoptosis analysis
The DLBCL cells were seeded (2 × 105 cells/mL) and treated with ZY0511 at the final concentrations of 0.5, 1, 2 μM for 48 h. Then, the DLBCL cells were harvested and stained with Annexin V-PE and 7-AAD according to BD’s instructions (San Diego, USA), followed by apoptosis analysis by FCM [10].
Mitochondrial membrane potential (ΔΨm) assay
The DLBCL cells were seeded (2 × 105 cells/mL) and treated with ZY0511 at the final concentrations of 0.5, 1, 2 μM for 48 h. Then, the DLBCL cells were harvested and incubated with tetraethyl benzimidazolyl carbocyanine iodide (JC-1) according to Beyotime’s instructions (Shanghai, China), followed by ΔΨm assay by FCM.
Real-Time Quantitative PCR (qRT-PCR)
Total RNA was isolated from cultivated DLBCL cells using AxyPrepTM Multisource Total RNA Miniprep Kit (Axygen, USA). PrimeScriptTM RT reagent Kit with Gdna Eraser (TakaRa, Japan) was used to synthesize cDNA. RNA quality was evaluated by Real-Time system (Bio-Rad, USA) using the SYBR® Green Supermix (Bio-Rad, USA). Primers were listed in Table 1.
Table 1.
Primers
Target
|
Forward primer
|
Reverse primer
|
GAPDH
|
CAGGAGGCATTGCTGATGAT
|
GAAGGCTGGGGCTCATTT
|
MYC
|
ATGCCCCTCAACGTTAGCTT
|
CTCCTCCTCGTCGCAGTAGA
|
PCNA
|
CCTGCTGGGATATTAGCTCCA
|
CAGCGGTAGGTGTCGAAGC
|
CDKN1A
|
AGGGGACAGCAGAGGAAGAC
|
GCCGTTTTCGACCCTGAGAG
|
ATM
|
TGCTTATCTGCTGCCGTCAA
|
TCAGGATCTCGAATCAGGCG
|
CDK4
|
GTGTACAAGGCCCGTGATCC
|
GTCGCCTCAGTAAAGCCACC
|
CDK6
|
CAGGTGGCCCTCGGAATAGA
|
ACATGACACCTACGAGGGCA
|
CCND1
|
GCCCTCGGTGTCCTACTTCAAATG
|
TCCTCCTCGCACTTCTGTTCCTC
|
FAS
|
TCTGGTTCTTACGTCTGTTGC
|
CTGTGCAGTCCCTAGCTTTCC
|
mTOR
|
GCACGTCAGCACCATCAACCTC
|
CTCAGCCATTCCAGCCAGTCATC
|
BNIP3
|
CAGCGTTCCAGCCTCGGTTTC
|
AGCTACTCCGTCCAGACTCATGC
|
ULK1
|
CTGCCTGTCGTCCACTGTGAAG
|
CCGCTGCTTGTCCAGGAAGAAG
|
ATG9A
|
AGCAGGTTCAGCGGGATGGAG
|
ACCACATTTGCGATAAGGCTCAGG
|
SQSTM1
|
TGATTGAGTCCCTCTCCCAGATGC
|
CCGCTCCGATGTCATAGTTCTTGG
|
ATG7
|
GAGCAAGCCCGCAGAGATGTG
|
TCCCAAAGCAGCATTGATGACCAG
|
ATG3
|
AGGCATACCTACCAACAGGCAAAC
|
CCATCCGCCATCACCATCATCTTC
|
MAP1LC3B
|
GCAGGGTAAACGGGCTGTGTG
|
GAGTGAGGACTTTGGGTGTGGTTC
|
BECN1
|
CCATGCAGGTGAGCTTCGT
|
GAATCTGCGAGAGACACCATC
|
RNA Sequencing (RNA-seq)
RNA-seq experiment was conducted using a profiler service provided by Novogene Co. Ltd (Beijing, China). After 48 h of treatment with DMSO or ZY0511 (1 μM), total RNA was purified from SU-DHL-4 cells and stored in TRIzol (Invitrogen, USA). Use a fold-change > 2.0, FDR (false discovery rate) < 0.05 and P < 0.05 (Student’s t-test) to filter significant probe sets for each biological sample (n = 3). Calculate the gene counts of each transcript and use DESeq2 for normalization to determine differentially expressed genes.
Immunofluorescence (IF)
After ZY0511 treatment, DLBCL cells were harvested and fixed with 4% paraformaldehyde at 4℃ for 15 min. The cell suspension was dripped onto a glass slide and placed at 37°C to dry the water. At room temperature, Permeabilize the DLBCL cells with 0.2% Triton X-100 solution for 20 min and block the permeabilized cells with PBST containing 0.2% BSA for 1 h. Then, incubate the slides with primary antibody overnight at 4°C, then incubate with cy3 or FITC-conjugated secondary antibody for 1 h at room temperature with shaking. Nuclei were labeled with DAPI. DeltaVision Ultra-high resolution microscope (GE Healthcare, USA) was used to analyze the slides using a 63× NA oil objective.
Transmission electron microscopy (TEM)
The DLBCL cells were seeded (2 × 105 cells/mL) and treated with ZY0511 at the final concentration of 2 μM for 48 h. The treated cells were fixed with 2.5% glutaraldehyde. Then, cells were embedded in epoxy resin and imaged by TEM (JEM-1400 Plus, Japan) following standard TEM procedures.
Subcutaneous xenograft models
NOD/SCID mice aged five- to six-week were purchased from the GemPharmatech Co., Ltd (Jiangsu, China) and fed under specific pathogen-free (SPF) barriers. The SU-DHL-6 Cells (2 × 106 cells/mouse/100 μL) were subcutaneously injected in the right flank of the mice. The tumor-bearing mice were randomly divided into three groups (n = 6 per group) when tumor volume reached 80-100 mm3. The ZY0511 (50 mg/kg and 100 mg/kg) or solvent were administrated once daily by intraperitoneal injection for 21 days. Tumor volumes and body weights were monitored every three days. Calculation formula: V (mm3) = (a × b2)/2 (V is the tumor volume, a is the length and b is the width). At the end of the experiment on day 21, the tumor tissues were stripped and fixed in 4% paraformaldehyde for further experiments.
Immunohistochemistry analysis and H&E staining
After treating with ZY0511 for 21 days, tumor tissues were collected from mice bearing SU-DHL-6 tumors. After being fixed in 4% paraformaldehyde for 48 h, the tumor tissues were embedded in paraffin, and then stained with Ki67 and PCNA by immunohistochemistry analysis. H&E staining tissue samples were the same as above.
Statistical analysis
Data are presented as the means ± SEM. GraphPad Prism 8 software was used to perform statistical analyses. The statistical significance of the data between two experimental groups was detected by a two-tailed Student's t test. The statistical significance of the data among multiple groups was tested with one-way ANOVA. The survival analysis was performed by the log-rank test. P < 0.05 were considered statistically significant.