Fungal mycoflora dysbiosis in gastric cancer

doi:10.21203/rs.3.rs-58045/v1

PDF

Research

Fungal mycoflora dysbiosis in gastric cancer

https://doi.org/10.21203/rs.3.rs-58045/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 17 Aug, 2020

You are reading this latest preprint version

Background: Bacterial infection is associated with gastric carcinogenesis. However, the relationship between nonbacterial components and gastric cancer (GC) has not been fully explored. We aimed to characterize the fungal mycobiome in GC.

Results: We observed significant gastric fungal dysbiosis in GC. Principal component analysis revealed separate clusters for the GC and control groups, and Venn diagram analysis indicated that the GC group showed a lower OTU abundance than the control. At the genus level, the abundances of 15 fungal biomarkers distinguished the GC group from the control, of which Candida (p = 0.000246) and Alternaria (p = 0.00341) were enriched in GC, while Saitozyma (p = 0.002324) and Thermomyces (p = 0.009158) were decreased. Combining the results of Welch’s t test and Wilcoxon rank sum test, C. albicans was significantly elevated in GC. The species richness Krona pie chart further revealed that C. albicans occupied 22% and classified GC from the control with an area under the receiver operating curve (AUC) of 0.743. Random forest analysis also confirmed that C. albicans could serve as a biomarker with a certain degree of accuracy. Moreover, compared with that of the control, the alpha diversity index was significantly reduced in the GC group. The Jaccard distance index and the Bray abundance index of the PCoA clarified separate clusters between the GC and control groups at the species level (p = 0.00051). Adonis (PERMANOVA) analysis and ANOVA showed that there were significant differences in fungal structure among groups (p = 0.001). Finally, FUNGuild functional classification predicted that saprotrophs were the most abundant taxa in the GC group.

Conclusions: This study revealed GC-associated mycobiome dysbiosis characterized by an altered fungal composition and ecology and demonstrated that C. albicans can be a fungal biomarker for GC. In addition, C. albicans may mediate GC by reducing the diversity and richness of fungi in the stomach, contributing to the pathogenesis of GC.

General Microbiology

gastric cancer

fungal dysbiosis

Candida albicans

mycobiome

biomarker

Gastric cancer (GC) is the fourth most common malignancy and one of the main causes of cancer-related deaths worldwide [1]. The majority of GC cases are the intestinal type of noncardia gastric cancer, which undergoes a predictable histological progression from atrophic gastritis (AG) to intestinal metaplasia (IM) and eventually to GC[2]. Initially, Helicobacter pylori infection causes inflammation of the gastric mucosa and destruction of related hydrochloric acid secreting glands, leading to atrophic gastritis [3]. Atrophic gastritis is a chronic inflamed, hypochloremic state, which may cause GC. Although it is known that H. pylori infection contributes to this cascade, only approximately 1–3% of infected individuals subsequently develop GC [4, 5]. Some host-related factors mentioned in the current research, including age, smoking status, genetic susceptibility and environmental factors, such as consumption of a high-salt diet and smoked foods containing nitrates, as well as microbial infections, have been shown to contribute to gastric carcinogenesis[6]. However, the relationship between gastric microbial components (such as fungi) other than H. pylori and GC has not been fully explored.

Over the past decade, due to the difficulty in culturing the commensal microorganisms that reside in the stomach, compared with intestinal flora, gastric flora studies are few, with only recent increases in studied on this topic [7]. In recent years, combined with advances in PCR techniques and metagenomics, the robust microbiome of the stomach has attracted extensive attention [8]. Most of the research efforts on the microbiome have focused on characterizing bacteria in healthy and diseased states, while the relatively low abundance of nonbacterial components has been neglected because of various technical challenges ranging from sample preparation to inadequate reference databases. Studies have provided evidence that bacteria, mainly the phyla Proteobacteria, Firmicutes, Actinobacteria and Fusobacteria [9, 10], can be regularly detected in gastric biopsies with gastric microbial dysbiosis associated with GC. Although H. pylori is still the main risk factor for histological changes, the chance of evolving GC after infection is not high, indicating that the presence of other components plays a key role in the development of GC.

With the advancement of high-throughput sequencing technology, sequencing methods provide access to the fungi of the gastric mycoflora. Genomic equivalence estimates that the fungal composition of the mammalian microbiota comprises less than 1% of all commensal microbial species, but fungi are significantly larger than bacteria in cell size and possess specialized metabolic gene clusters in response to specific ecological needs. Emerging research has revealed that fungi play a stable role in the development and maintenance of the host immune system and can be altered in various diseases [11, 12]. The latest Nature journal reports that fungi, like bacteria, can also be transferred from the intestine to the pancreas, and related changes in the fungal mycobiome promote pancreatic oncogenesis[13]. Thus, the dynamic exploration of the changes in the composition of gastric fungi in the progression from health to GC not only provides direction for future high-throughput fungal sequencing research on tumors but is also essential for further investigating the mechanisms of gastric carcinogenesis other than Helicobacter pylori.

In this study, we characterized fungal compositional and ecological changes by analyzing metagenomic sequences in cancer lesions and adjacent noncancerous tissues of 45 patients with GC. Candida albicans was also discovered as a fungal indicator for GC. For the first time, we used ITS sequencing to demonstrate the importance of fungi in the pathogenesis of GC, providing a theoretical scientific basis for the development of potential prevention and treatment strategies.

Sample collection and PCR amplification

A total of 90 samples were obtained from 45 pairs of patients diagnosed with GC at the First Affiliated Hospital of China Medical University, Shenyang, China. Surgical biopsies were obtained from sites of cancer lesions and adjacent noncancerous tissues in each patient. All specimens were stored at -80 °C until DNA extraction. In addition, subjects provided informed consent for obtaining study specimens, and the study was approved by the Clinical Research Ethics Committees of the First Affiliated Hospital of China Medical University.

Microbial DNA was extracted using HiPure DNA Kits (Magen, Guangzhou, China) according to the manufacturer’s protocols. The internal transcribed spacer (ITS) of the ITS2 region between the 18S and 28S genes of the ribosomal DNA gene was amplified by PCR (94 °C for 2 min, 30 cycles at 98 °C for 10 s, 62 °C for 30 s, and 68 °C for 30 s, and a final extension at 68 °C for 5 min) using the fungal-specific primers ITS3_KYO2: GATGAAGAACGYAGYRAA and ITS4: TCCTCCGCTTATTGATATGC [14]. PCRs were performed in triplicate in a 50-µL mixture containing 5 µL of 10 × KOD buffer, 5 µL of 2 mM dNTPs, 3 µL of 25 mM MgSO4, 1.5 µL of each primer (10 µM), 1 µL of KOD polymerase, and 100 ng of template DNA. The related PCR reagents used in the experiment were from TOYOBO, Japan.

Metagenomics sequencing

Amplicons were extracted from 2% agarose gels, purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to the manufacturer’s instructions and quantified using the ABI StepOnePlus Real-Time PCR System (Life Technologies, Foster City, USA). The purified amplicons were pooled in equimolar amounts and paired-end sequenced (PE250) on an Illumina platform according to standard protocols. The raw reads were deposited into the NCBI Sequence Read Archive (SRA) database.

Quality control and read assembly

Raw data containing adapters or low-quality reads affect subsequent assembly and analyses. Thus, to obtain high-quality clean reads, the raw reads were further filtered according to the following rules using FASTP [15] (version 0.18.0): reads containing more than 10% of unknown nucleotides-(N) and reads with less than 50% of bases with a quality value (Q-value) > 20 were removed. Paired-end clean reads were merged as raw tags using FLASH [16] (version 1.2.11) with a minimum overlap of 10 bp and a mismatch error rate of 2%.

The noisy sequences of raw tags were filtered using the QIIME [17] (version 1.9.1) pipeline based on specific filtering conditions [18] to obtain high-quality clean tags. The filtering conditions were as follows: briefly, raw tags from the first low-quality base site where the number of bases in the continuous low-quality value (the default quality threshold is < = 3) reached the set length (the default length is 3) were broken. Then, tags whose continuous high-quality base length was less than 75% of the tag length were filtered.

OTU and community composition analyses

The effective tags were clustered into operational taxonomic units (OTUs) with at least 97% similarity using the UPARSE [19] (version 9.2.64) pipeline. The tag sequence with the highest abundance was selected as the representative sequence within each cluster. For the analyses between groups, Venn diagram-based analyses were performed in the R project VennDiagram package [20] (version 1.6.16), and an upset plot was developed in the R project UpSetR package [21] (version 1.3.3) to identify unique and common OTUs.

The representative sequences were classified into organisms by a naive Bayesian model using the RDP classifier [22] (version 2.2) based on the ITS2[23] database (version update_2015), with a confidence threshold value of 0.8. The abundance statistics of each taxa were visualized using Krona [24] (version 2.6). The stacked bar plot of the community composition was visualized in the R project ggplot2 package [25] (version 2.2.1). Circular layout representations of species abundance were graphed using Circos [26] (version 0.69-3). A heatmap of species abundance was plotted using the pheatmap package (version 1.0.12) [27] in the R project.

Statistical analysis

The random forest package [28] (version 4.6.12), pROC package [29] (version 1.10.0) and labdsv package [30] (version 2.0–1) were used in the R project. A ternary plot of species abundance was plotted using the R ggtern package [31] (version 3.1.0). Chao1, Simpson and all other alpha diversity indexes were calculated in QIIME [17] (version 1.9.1). Comparisons of the alpha indexes between groups were performed with Welch’s t-test and Wilcoxon rank test using the R project [32] (version 2.5.3).

The R project [32] (version 2.5.3) was also used to analyze the data based on multivariate statistical techniques, including Jaccard and Bray-Curtis distance matrixes, principal component analysis (PCA), principal coordinate analysis (PCoA) and nonmetric multidimensional scaling (NMDS) of weighted UniFrac distances, and the results were plotted in the R project ggplot2 package [25] (version 2.2.1). Welch’s t-test, Wilcoxon rank test, Adonis (also called PERMANOVA) and ANOSIM test were performed using the R project, and the functional groups (guilds) of the fungi were inferred using FUNGuild[33] (version 1.0).

Gastric fungal dysbiosis is associated with GC

We evaluated 90 samples from 45 pairs of patients and divided them into a GC group and a control group (adjacent noncancerous tissue) for comparison. We also analyzed the clinical characteristics closely related to GC and found no significant differences. The detailed characteristics of the patients are shown in Table S1. We first assessed and compared the fungal composition in the specimens. The PCA showed that the GC and control groups aggregated separately, revealing that the gastric mucosal fungal community discriminated GC and the control into two significantly distinct groups. The GC group exhibited more unique fungal profiles than the control group (Fig. 1a, Table S2). To clarify the OTU crossover between different groups, we used a Venn diagram to indicate the differences among the groups according to OTU abundance. We found that both groups shared a total OTU abundance of 207. Simultaneously, the GC group showed a lower OTU abundance than the control group (Fig. 1b). Based on these OTU clustering results, it is suggested that alterations in stomach fungal composition may lead to gastric carcinogenesis.

Taxonomic coverage and alterations of fungi in GC

For the distribution of fungal taxa, in both the GC and control groups, the phylum Ascomycota was the dominant mycoflora, and Basidiomycota was considered to be the second most abundant phylum (Fig. 2a). The corresponding species abundance heat map is shown in Fig. 2b. We further analyzed the differences at the lower taxonomic level of class, finding a significant depletion of Eurotiomycetes, Agaricomycetes, Tremellomycetes, Microbotryomycetes and Mortierellomycetes and enrichment of Saccharomycetes and Dothideomycetes in the GC group compared with the control group (Fig. 2c). At the family level, we found 17 fungi with significant differences (Table S3), so we only showed data with a P value less than 0.01. Pseudeurotiaceae, Trimorphomycetaceae, Chaetomiaceae and Aspergillaceae were significantly decreased in the GC group, while Saccharomycetales_fam_Incertae_sedis and Pleosporaceae were increased, compared to the control (Fig. 2d). Furthermore, at the genus level, there were 15 different fungi between the two groups (Table S4); 2 fungal genera were enriched in the GC group, including Candida (p = 0.000246) and Alternaria (p = 0.00341), while Saitozyma (p = 0.002324) and Thermomyces (p = 0.009158) were decreased, compared to the control (Fig. 2e).

Candida albicans as a fungal indicator species for GC

To better identify fungal taxa with value as potential GC indicators, we evaluated fungal alterations at the species level. We initially used Welch’s t test and found that there were 13 species with significant differences in the mean abundance when comparing the two groups (Table S5). Then, the Wilcoxon rank sum test was applied to determine whether the median species abundance was statistically significant, and we confirmed that 59 species had significant differences between the two groups (Table S6). The species with higher contents and greater than two-fold changes in abundance were selected for the next analysis.

With the Welch’s t test, Candida albicans (p = 0.000015) and Fusicolla acetilerea (p = 0.01691) were increased, while Aspergillus montevidensis (p = 0.001437), Saitozyma podzolica (p = 0.002324) and Penicillium arenicola (p = 0.00722) were obviously decreased in the GC group (Fig. 3a). With the Wilcoxon rank sum test, the abundance of C. albicans (p = 0.000072), Arcopilus aureus (p = 0.040759) and Fusicolla aquaeductuum (p = 0.026626) was higher in the GC group, while Candida glabrata (p = 0.014443) and Aspergillus montevidensis (p = 0.000586) were less abundant, compared to the control (Fig. 3b). These results demonstrated that Candida albicans was significantly elevated in the GC group (p < 0.0001). Next, we dynamically displayed the composition of species at different classification levels through the species composition pie chart and found that the abundance of C. albicans at the species level accounted for 22% (Fig. 3c, Table S7). We evaluated the accuracy based on the ROC curve and observed an AUC value of 0.743 (Fig. 3d). Random forest analysis was used to screen potential indicator species, and the values of the Gini index (Fig. 4a) and the mean decrease in accuracy (Fig. 4b) were the largest for C. albicans. Combined with the indicator analysis, we comprehensively considered the strong indicator ability of C. albicans among the groups (Fig. 4c). These results all indicated that C. albicans had an obvious effect in distinguishing GC and non-GC tissues and can be used as a biomarker with a certain degree of accuracy.

Altered fungal microbiota diversity in GC

Next, we conducted a diversity analysis to further understand the species richness and flora structure among the groups. Alpha diversity indexes (Chao1, ACE, Sobs, Shannon, Simpson and Good’s Coverage) were significantly reduced in the GC group compared with those of the control (Fig.S1, Table S8). Briefly, we measured fungal alpha diversities and determined whether, through a t test (Fig. 5a-e) or rank sum test, five indexes, namely, the Chao1, ACE, Sobs, Shannon and Simpson indexes, were significantly different between the GC and control groups (P < 0.05) (Table 1).

Table 1

Difference of alpha diversity index between the GC and control groups.
Group	Testing method	Index	P value
GC-VS-Control	T-test	Sobs	0.001267
		Shannon	0.000003
		Simpson	0.000156
		Chao	0.001763
		Ace	0.006286
	Wilcoxon	Sobs	0.0118
		Shannon	0.000001
		Simpson	0.000001
		Chao	0.025431
		Ace	0.044121

We used PCoA to analyze two classic beta diversity indexes, the Jaccard distance index (Fig. 5f) and the Bray abundance index (Fig. 5g), and confirmed separate clusters for the GC and control groups at the species level. To overcome the shortcomings of linear models (PCA, PCoA) and better reflect the nonlinear structure, we evaluated the accuracy of the model through NMDS stress values. We ensured the reliability of the model, confirming that the stress values of the Jaccard and Bray indexes were less than 0.1 (Fig. 5h). The significant difference of the two indexes between groups was shown by the Wilcoxon rank sum test at the genus level (P = 0.00051, Fig. 5i-j). We then evaluated and verified the fungal composition in our groups. Both Adonis (PERMANOVA) analysis (Table S9) and the ANOSIM test (Fig. 5k) revealed that there were significant differences in fungal structure between the GC and control groups. Combining the two diversity index results, our analysis suggested that with gastric carcinogenesis, the richness of the related fungal composition decreases, and the structure of the fungal community is quite different.

Ecological guilds of sampled taxa

Based on the OTU abundance, we used FUNGuild to perform functional classification prediction. The fungal taxa were grouped into 83 ecological guilds, and the most diverse guild was undefined saprotrophs (Fig.S2a). In addition, trophic mode divided fungal taxa into 9 types, of which the most diverse type was saprotrophs (Fig. S2b). In particular, heatmaps were drawn to describe the functional predictions under the two analytical methods, as shown in Fig. 6a and Fig. 6b, respectively. Thus, our analyses showed that a symbiotic ecological relationship may be important for the homeostasis of gastric fungi, while malnutrition might provide a suitable environment for the fungal dysbiosis of GC and ultimately contribute to the negative effects of gastric carcinogenesis.

Gastric cancer causes one of the major types of digestive tract tumor worldwide [1]. After the continuous development of high-throughput sequencing technology, research on the correlation between gastric flora (other than Helicobacter pylori) and GC has gradually emerged. In this study, we tried to describe the fungal spectrum associated with GC, which has not been explained to date; the focus was on gastric fungal dysbiosis caused by GC. Compared with fecal samples, the colonization performance of tissue samples can better demonstrate the dynamic changes in the surrounding environment for gastric carcinogenesis. Therefore, we analyzed the ITS metagenome sequences of cancer lesions and adjacent noncancerous tissues to investigate the composition and ecological alterations of fungi associated with GC and identify fungal indicators. To ensure that the most effective data were clustered into OTUs, we filtered low-quality reads, and assembled and refiltered the data. After obtaining the OTUs, under the condition that the GC and control groups were effectively grouped, we carried out species identifications and alpha and beta diversity analysis, and compared differences between groups. Candida albicans was identified for the first time as a key fungus that can be used to distinguish between GC and control groups. We also combined FUNGuild functional annotation to study fungal functions from other ecological perspectives. For the first time, we showed the characteristics of the fungal flora in the stomach tissues of GC patients, demonstrating fungal malnutrition in the GC ecosystem and proving that C. albicans can be used as a biomarker with a certain degree of accuracy.

We clarified specific fungal composition changes in GC. Overall, the GC group showed a lower OTU abundance. At the phylum level, Ascomycota was the most enriched in the GC group compared with the control group, while Basidiomycota was less enriched. We further analyzed the differences at lower taxonomic levels and finally, at the species level, confirmed that C. albicans, Fusicolla acetilerea, Arcopilus aureus and Fusicolla aquaeductuum were excessively colonized in the GC tissue. At present, C. albicans is the most researched of these organisms with regard to its role in various diseases. This species normally exists in the body and does not cause damage. However, when the host's defense capacity is weakened, C. albicans will cause disease. Therefore, C. albicans is recognized as an opportunistic pathogen. Since immunosuppression caused by cancer chemotherapy promotes C. albicans infection, the relationship between C. albicans and cancer development or progression has been widely reported. For example, for hematological malignancies or solid tumors, up to 35% of patients with underlying disease have candidiasis, and the most common underlying disease among patients with candidiasis is also solid tumor [34]. Candida albicans can produce carcinogenic nitrosamines, which can cause abnormal proliferative changes in oral epithelial cancer [35]. The risk of malignant transformation of oral leukoplakia is higher than that of oral lichenoid lesions, and C. albicans strains isolated from patients can produce more carcinogenic acetaldehyde in ethanol [36]. The role of C. albicans in tumor adhesion and metastasis has been associated with TNF-α and IL-18 [37–39]. Recently, Bertolini et al. confirmed that C. albicans induced mucosal bacterial malnutrition and promoted invasive infection [40].

Notably, we first confirmed the indicative role of C. albicans in GC. In our study, compared with the control, the species richness of C. albicans occupied 22% in the GC group. Both the Welch's t test and Wilcoxon rank sum test confirmed that C. albicans was significantly more abundant in the GC group than the control group. In addition, the ROC curve showed that the AUC value of C. albicans was 0.743. Combined with the results of the Gini index and the mean decrease in accuracy, all results indicated that C. albicans could be used as a biomarker with a certain degree of accuracy. By diversity analysis, compared with the control group, the GC group had a decrease in species richness, diversity and uniformity. The structure of the species flora between the groups also showed a significant change, suggesting that C. albicans has an adverse effect on the diversity and richness of the stomach microbiome. Aykut et al. stated that identifying the species most associated with cancer may guide future attempts to use targeted antifungal drugs to slow tumor growth and avoid side effects and reported Malassezia as a pathogenic fungus associated with pancreatic cancer that promotes pancreatic oncogenesis via activation of MBL[13]. Our discovery that C. albicans may have contributed to the pathogenesis of GC not only lays a scientific foundation for the exploration of innovative therapies for GC but also provides a new idea for treating specific patients by adjusting their intestinal microbial flora as an adjuvant therapy or developing immunotherapies for targeted control of fungal infections, which is worthy of further study.

Due to the current lack of fungal genomic data, we integrated published article data and used FUNGuild to predict fungal functions from other ecological perspectives based on OTU abundance. The guild classification revealed that the most diverse guilds were undefined saprotrophs. Simultaneously, the trophic mode implied that the most diverse fungal type was the saprotrophs. Our analysis clarified the importance of fungal homeostasis in the stomach and showed that fungal dysbiosis eventually promotes the occurrence of GC.

In conclusion, compared with most studies focusing on the bacterial spectrum associated with GC, our study described the gastric fungal dysbiosis in gastric carcinogenesis for the first time and showed that C. albicans can be used as a fungal marker for GC. In addition, C. albicans may mediate GC by reducing the diversity and richness of fungi in the stomach, contributing to the pathogenesis of GC. We also revealed the importance of homeostasis for gastric fungi. Additional analysis investigating the potential role of C. albicans in gastric carcinogenesis is warranted to delineate its use as a noninvasive biomarker for GC diagnosis.

gastric cancer

AUC

area under the receiver operating curve

C. albicans

Candida albicans

atrophic gastritis

intestinal metaplasia

ITS

internal transcribed spacer

SRA

Sequence Read Archive

OUTs

operational taxonomic units

PCA

principal component analysis

PCoA

principal coordinate analysis

NMDS

nonmetric multidimensional scaling

Ethics approval and consent to participate

The study was approved by the Clinical Research Ethics Committees of the First Affiliated Hospital of China Medical University.

Consent for publication

Not applicable.

Availability of data and material

All data generated or analyzed during this study are included in this published article and its supplementary information files.

Competing interests

The authors declare that they have no competing interests.

Funding

This research was supported by the Outstanding Youth Fund Project of Fujian Province (2018D0016).

Authors' contributions

MYZ, XHH and YXS designed the study. MYZ, YBX and JBZ conducted the experiments. YBX, ZG, JSM and ZXW analyzed the results. XHH and YXS collected the clinical samples. MYZ, YBX and XHH collectively conceptualized the manuscript. YXS edited the manuscript and provided critical comments. All the authors reviewed and approved the final version of the manuscript.

Acknowledgments

We would like to thank the First Affiliated Hospital of China Medical University for providing clinical samples and the entire research team for their contributions and support.

Availability of supporting data

The raw reads were deposited into the NCBI SRA database (Accession Number: SRA: SRP276371 and Bioproject PRJNA650666).

Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. 2019;69:7–34.
Park YH, Kim N. Review of atrophic gastritis and intestinal metaplasia as a premalignant lesion of gastric cancer. J Cancer Prev. 2015;20:25–40.
Amieva M, Peek RM Jr. Pathobiology of Helicobacter pylori-Induced Gastric Cancer. Gastroenterology. 2016;150:64–78.
Stewart OA, Wu F, Chen Y. The role of gastric microbiota in gastric cancer. Gut Microbes. 2020;11:1220–30.
Peek RM Jr, Crabtree JE. Helicobacter infection and gastric neoplasia. J Pathol. 2006;208:233–48.
Compare D, Rocco A, Nardone G. Risk factors in gastric cancer. Eur Rev Med Pharmacol Sci. 2010;14:302–8.
Sheh A, Fox JG. The role of the gastrointestinal microbiome in Helicobacter pylori pathogenesis. Gut Microbes. 2013;4:505–31.
Monstein HJ, Tiveljung A, Kraft CH, Borch K, Jonasson J. Profiling of bacterial flora in gastric biopsies from patients with Helicobacter pylori-associated gastritis and histologically normal control individuals by temperature gradient gel electrophoresis and 16S rDNA sequence analysis. J Med Microbiol. 2000;49:817–22.
Nardone G, Compare D. The human gastric microbiota: Is it time to rethink the pathogenesis of stomach diseases? United European Gastroenterol J. 2015;3:255–60.
Coker OO, Dai Z, Nie Y, Zhao G, Cao L, Nakatsu G, Wu WK, Wong SH, Chen Z, Sung JJY, Yu J. Mucosal microbiome dysbiosis in gastric carcinogenesis. Gut. 2018;67:1024–32.
Coker OO, Nakatsu G, Dai RZ, Wu WKK, Wong SH, Ng SC, Chan FKL, Sung JJY, Yu J. Enteric fungal microbiota dysbiosis and ecological alterations in colorectal cancer. Gut. 2019;68:654–62.
Lai GC, Tan TG, Pavelka N. The mammalian mycobiome: A complex system in a dynamic relationship with the host. Wiley Interdiscip Rev Syst Biol Med. 2019;11:e1438.
Aykut B, Pushalkar S, Chen R, Li Q, Abengozar R, Kim JI, Shadaloey SA, Wu D, Preiss P, Verma N, et al. The fungal mycobiome promotes pancreatic oncogenesis via activation of MBL. Nature. 2019;574:264–7.
Toju H, Tanabe AS, Yamamoto S, Sato H. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples. PLoS One. 2012;7:e40863.
Chen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018;34:i884–90.
Magoc T, Salzberg SL. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics. 2011;27:2957–63.
Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Pena AG, Goodrich JK, Gordon JI, et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 2010;7:335–6.
Bokulich NA, Subramanian S, Faith JJ, Gevers D, Gordon JI, Knight R, Mills DA, Caporaso JG. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat Methods. 2013;10:57–9.
Edgar RC. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat Methods. 2013;10:996–8.
Chen H, Boutros PC. VennDiagram: a package for the generation of highly-customizable Venn and Euler diagrams in R. BMC Bioinformatics. 2011;12:35.
Conway JR, Lex A, Gehlenborg N. UpSetR: an R package for the visualization of intersecting sets and their properties. Bioinformatics. 2017;33:2938–40.
Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol. 2007;73:5261–7.
Ankenbrand MJ, Keller A, Wolf M, Schultz J, Forster F. ITS2 Database V: Twice as Much. Mol Biol Evol. 2015;32:3030–2.
Ondov BD, Bergman NH, Phillippy AM. Interactive metagenomic visualization in a Web browser. BMC Bioinformatics. 2011;12:385.
ggplot2. An implementation of the Grammar of Graphics [ URL: http://CRAN. R-project. org/package = ggplot2].
Krzywinski M, Schein J, Birol I, Connors J, Gascoyne R, Horsman D, Jones SJ, Marra MA. Circos: an information aesthetic for comparative genomics. Genome Res. 2009;19:1639–45.
Kolde RKMR. Kolde M R. Package ‘pheatmap’[J]. Package ‘pheatmap’[J] 2015, 1(7).
Liaw AWM. Classification and regression by randomForest[J]. R news. 2002;2(3):18–22.
Robin X, Turck N, Hainard A, Tiberti N, Lisacek F, Sanchez JC, Muller M. pROC: an open-source package for R and S + to analyze and compare ROC curves. BMC Bioinformatics. 2011;12:77.
Roberts DW RMDW: Package ‘labdsv’[J]. Ordination and Multivariate 2016.
Hamilton NE. FM: ggtern: Ternary diagrams using ggplot2[J]. Journal of Statistical Software 2018:87(81): 81–17.
Oksanen JBFG, Kindt R, et al.: Vegan: community ecology package.. 2010, 23: 2010.
Nguyen NH, et al. FUNGuild: an open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecology. 2016;20:241–8.
Zirkel J, Klinker H, Kuhn A, Abele-Horn M, Tappe D, Turnwald D, Einsele H, Heinz WJ. Epidemiology of Candida blood stream infections in patients with hematological malignancies or solid tumors. Med Mycol. 2012;50:50–5.
Sanjaya PR, Gokul S, Gururaj Patil B, Raju R. Candida in oral pre-cancer and oral cancer. Med Hypotheses. 2011;77:1125–8.
Gainza-Cirauqui ML, Nieminen MT, Novak Frazer L, Aguirre-Urizar JM, Moragues MD, Rautemaa R. Production of carcinogenic acetaldehyde by Candida albicans from patients with potentially malignant oral mucosal disorders. J Oral Pathol Med. 2013;42:243–9.
Ramirez-Garcia A, Arteta B, Abad-Diaz-de-Cerio A, Pellon A, Antoran A, Marquez J, Rementeria A, Hernando FL. Candida albicans increases tumor cell adhesion to endothelial cells in vitro: intraspecific differences and importance of the mannose receptor. PLoS One. 2013;8:e53584.
Rodriguez-Cuesta J, Hernando FL, Mendoza L, Gallot N, de Cerio AA, Martinez-de-Tejada G, Vidal-Vanaclocha F. Candida albicans enhances experimental hepatic melanoma metastasis. Clin Exp Metastasis. 2010;27:35–42.
Ramirez-Garcia A, Rementeria A, Aguirre-Urizar JM, Moragues MD, Antoran A, Pellon A, Abad-Diaz-de-Cerio A, Hernando FL. Candida albicans and cancer: Can this yeast induce cancer development or progression? Crit Rev Microbiol. 2016;42:181–93.
Bertolini M, Ranjan A, Thompson A, Diaz PI, Sobue T, Maas K, Dongari-Bagtzoglou A. Candida albicans induces mucosal bacterial dysbiosis that promotes invasive infection. PLoS Pathog. 2019;15:e1007717.

PDF

Version 1

posted 17 Aug, 2020

You are reading this latest preprint version

Fungal mycoflora dysbiosis in gastric cancer

Status:

Version 1

Abstract

Figures

Background

Methods

Sample collection and PCR amplification

Metagenomics sequencing

Quality control and read assembly

OTU and community composition analyses

Statistical analysis

Results

Gastric fungal dysbiosis is associated with GC

Taxonomic coverage and alterations of fungi in GC

Candida albicans as a fungal indicator species for GC

Altered fungal microbiota diversity in GC

Ecological guilds of sampled taxa

Discussion

Conclusions

Abbreviations

Declarations

Ethics approval and consent to participate

Consent for publication

Availability of data and material

Competing interests

Funding

Authors' contributions

Acknowledgments

Availability of supporting data

References

Supplementary Files

Status:

Version 1