2.1 Chemicals and reagents
Dexamethasone (in ampoules) was purchased from Shuanghe Pharmaceutical Company (Wuhan, China). Isoflurane was obtained from Baxter Healthcare Co. (Deerfield, IL, USA). Rat corticosterone and human cortisol enzyme-linked immunosorbent assay (ELISA) kits were obtained from Assay pro LLC. (Saint Charles, MO, USA). BCA Assay Kit was from Sigma-Aldrich Co., Ltd. (St Louis, MO, USA). The antibodies of StAR (ab203193), SF1 (ab65815), histone deacetylase 5 (HDAC5) (ab55403) and glucocorticoids receptor (GR) (ab183127) were purchased from AbcamCo., Ltd. (Cambridge, UK). Acetyl histone 3 lysine 9 (H3K9ac) (A7255), H3K14ac (A7254), H3K27ac (A7253) goat anti-rabbit IgG (AC005) were purchased from ABclonal Technology Co., Ltd. (Wuhan, China). DNA purification kit (Q5314) was purchased from TIANGEN Biotech Co., Ltd. (Beijing, China). GR siRNA and HDAC5 siRNA sequences were synthesized by Gene Pharma (Shanghai, China). Trizol reagent kit was obtained from Omega Bio-Tek (Doraville, Georgia USA). Reverse transcription and real-time quantitative polymerase chain reaction (RT-qPCR) kits were purchased from SYBR GREEN Biotechnology Co., Ltd. (Dalian, China). All the oligonucleotide primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). Other chemicals and agents were of analytical grade.
2.2 Animals and treatment
Animal experiments performed in the present study were approved by the Animal Welfare Committee at Wuhan University (Wuhan, China), and in accordance with the Guidelines for the Care and Use of Laboratory Animals at Wuhan University (No.14016). Specific pathogen-free Wistar rats [No. 2012–2014, certification number: 42000600002258, license number: SCXK(Hubei)], weighing 180–220 g (female) and 260–300 g (male), were obtained from the Experimental Center of the Hubei Medical Scientific Academy (Wuhan, China). After 1 week of accommodation, one male and two female rats were placed together overnight for mating. Gestational day (GD) 0 was determined upon confirmation of mating by the appearance of sperm in a vaginal smear. Pregnant rats were transferred to individual cages and then randomly divided into control, PDE(L) and PDE(H) groups. From GD9 to GD20, the PDE(L) and PDE(H) group were subcutaneously injected with 0.2 and 0.8 mg/kg.d dexamethasone, and the control group received the same volume of the distilled water.
On GD20, part of pregnant rats was anesthetized with 3% isoflurane and then sacrificed, fetuses were weighed after being dried on filter papers. Pregnant rats with litter sizes of 12 to 14 were considered qualified. Briefly, fetal blood samples were collected, serum and PBMC were isolated, and fetal adrenals were collected. The samples collected from littermates were pooled, immediately frozen in liquid nitrogen, and stored at − 80°C for subsequent analyses. The remaining pregnant rats in control and PDE(L) groups were allowed to delivery normally. The number of pregnant rats with the litter size of 8–14 at birth was assigned to 12 (6 male pups and 6 female pups) for each group. After weaning on postnatal week (PW) 4, the offspring rats were given normal diet. On PW6, PW8 and PW28, the rats were anesthetized with 3% isoflurane in a room separated from others, the sample collection was similar to that in utero.
2.3 Serum corticosterone and cell medium cortisol concentration measurements
The concentration of serum corticosterone and cell medium cortisol were measured by ELISA kits, following the manufacturer's protocols. The intra-assay and inter-assay coefficients of variation for corticosterone and cortisol determination were 5.0% and 7.2%, respectively.
2.4 Total RNA extraction and RT-qPCR
Total RNA was isolated from offspring rat adrenals using Trizol reagent according to the manufacturer’s protocol. For RT-qPCR analysis, single-strand cDNA was prepared from 1 g of total RNA according to the protocol of the Exscript RT reagent kit. Primers were designed using Primer Premier 5.0, and their sequences are shown in Table 1. PCR assays were performed in 96-well optical reaction plates using the ABI Step real-time PCR thermal cycler (ABI Stepone, NY, USA). To precisely quantify gene transcripts, the mRNA level of the housekeeping gene glyceraldehyde phosphate dehydrogenase (GAPDH) was measured as the quantitative control, and each sample was normalized to the GAPDH mRNA content. PCR cycling conditions were as follows: pre-denaturation, 95℃ for 30 s; denaturation, 95℃ for 5 s; gene-specific annealing conditions were listed in Supplemental Tables 1 and 72℃ for 30 s for elongation.
Table 1
Oligonucleotide primers and conditions of real-time quantitative polymerase chain reaction (RT-PCR).
Genes | Forward primer | Reverse primer | Product (bp) | Annealing |
SF1 | CCAGTACGGCAAGGAAGA | GAGGCTGAAGAGGATGAGGA | 193 | 63°C, 30 s |
StAR | GGGAGATGCCTGAGCAAAGC | GCTGGCGAACTCTATCTGGGT | 188 | 65°C, 30 s |
P450scc | GCTGCCTGGGATGTGATTTTC | GATGTTGGCCTGGATGTTCTTG | 156 | 63°C, 30 s |
3βHSD | TCTACTGCAGCACAGTTGAC | ATACCCTTATTTTTGAGGGC | 271 | 58°C, 30 s |
P450c21 | AGGAGCTGAAGAGGCACAAG | GAGGTAGCTGCATTCGGTTC | 306 | 63°C, 30 s |
P450c11 | CCCCTTTGTGGATGTGGTAG | CACGCTCTCAGGTTTCAGGT | 190 | 61°C, 30 s |
GR | CACCCATGACCCTGTCAGTC | AAAGCCTCCCTCTGCTAACC | 156 | 63°C, 30 s |
HDAC5-R | CCCATTGGAGATGTGGAATAC | TCTGGCGGTGACAGAATA | 210 | 61°C, 30 s |
GAPDH-R | GCAAGTTCAATGGCACAG | GCCAGTAGACTCCACGACA | 140 | 63°C, 30 s |
GR-H | TTCTGACTGGGGCCAATGAA | AATGATGGTGGCCTCGAGA | 151 | 60°C,30 s |
StAR-H | ACAGGTACGAGAGGGATGCT | CCATCACTCTCCAGCCCTTG | 234 | 60°C,30 s |
HDAC5-H | CTCTGTGCTCTACATCTCTCT | TGTAAGGTACTCCACGTCTC | 185 | 60°C,30 s |
SF1-H | CCCAGGTACCCTTCTCCCAG | TGCCGAGCTGTAAAACCCAA | 316 | 61°C, 30 s |
GAPDH-H | ACGAGCCCACATTTCCCAAT | TGAGAATGGCTGCTCCCTTG | 186 | 60°C, 30 s |
SF1: steroidogenic factor 1; StAR: steroidogenic acute regulatory; P450scc: cytochrome P450 cholesterol side-chain cleavage; 3βHSD: 3β-hydroxysteroid dehydrogenase; P450c21: steroid 21-hydroxylase; P450c11: steroid 11β-hydroxylase; GR: glucocorticoids receptor; HDAC5: histone deacetylase 5; GAPDH: glyceraldehyde 3-phosphate dehydrogenase. R: rat; H: human.
Table 2
Human and rat primers used for Chromatin immunoprecipitation-polymerase chain reaction (ChIP-PCR).
Genes | Forward primer (5’-3’) | Reverse primer (5’-3’) | Annealing |
SF1 (human) | CTGCGCGCCATTCTCCAGC | TACGTGGTCGGGTGATCATGA | 60℃, 30 s |
SF1 (rat) | CAGTGTATGTGATGCTGGGG | GAGTCTGAAGAGCTGAGGTC | 60℃, 30 s |
GR-SF1 binding(human) | ACGCCATTTATCAACGAAATCA | TGCAACAGAATCCGGAAATACC | 60℃, 30 s |
SF1: steroidogenic factor 1, GR: glucocorticoids receptor.
2.5 Histological and immunohistochemical analysis
Adrenals were fixed in 4% paraformaldehyde overnight and processed with the paraffin sectioning technique. 5 µm-thick slices were prepared and routinely stained with hematoxylin–eosin (H&E). Every 5th section of the series was saved, observed and photographed with an Olympus AH-2 light microscope (Olympus, Tokyo, Japan). On these sections, the maximal cross-sectional areas of adrenal were determined.
To observe the specific protein expression, adrenals were fixed in 4% paraformaldehyde for 24 h, embedded with paraffin. Samples were cut into 5 µm-thick slices along the longitudinal axis. The immunohistochemical procedures were performed using a streptavidin-peroxidase (SP)-conjugated method according to the manufacturer’s instructions. Briefly, 3% H2O2 was added for 10 min to block endogenous peroxidase activity, and pre-immune goat serum was used to block the non-specific binding sites. The sections were then incubated at 37℃ for 20 min with an anti-StAR antibody (1:400), anti-SF1 antibody (1:300), anti-HDAC5 antibody (1:500), or anti-GR antibody (1:500). For a negative staining control, PBS was used in place of the antibodies. The signal was visualized using light microscopy, imaged and the positively stained areas were analyzed using the Photo Imaging System (HMIAS-2000, Guangzhou, China).
2.6 Cell culture and treatment
Human adrenocortical H295R cells were seeded in a culture medium (DMEM/F12 medium with 10% fetal bovine serum, 1% streptomycin and penicillin) at 37℃ in an atmosphere of 95% air and 5% CO2. The cells were treated with dexamethasone (20, 100, and 500 nM for 48 h; or 500 nM for 12, 24, 48 h). MTS assay was conducted to detect the cytotoxicity of dexamethasone following the manufacturer’s protocol. Absorption intensity was measured at 490 nm using a microplate reader. With the same treatment, the cortisol concentration in culture medium, mRNA and protein expression of related genes were measured. H295R cells were treated with 500 nM dexamethasone for 24 h to detected expression of GR and StAR protein, the binding between GR and SF1, and H3K27ac level of SF1 promoter region. For the knockdown of GR or HDAC5, the cells were transfected with siRNA targeting human GR or HDAC5 at a final concentration of 100 pM using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The siRNA sequences of GR were F: 5’-GGAGAUGACAACUUGACUUTT-3’, R: 5’-AAGUCAAGUUGUCAUCUCCTT-3’; the siRNA sequences of HDAC5 were F: 5’-GCUAUGACAACGGGAACUUTT-3’, R: 5’-AAGUUCCCGUUGUCAUAGCTT-3’. After a 24 h treatment, the cells were harvested for subsequent treatment and analysis.
2.7 Western blotting analysis
Homogenate tissues or cells were rinsed with ice-cold PBS and then lysed for 30 minutes at 4°C in RIPA lysis buffer containing phosphatase inhibitor cocktail, followed by the BCA Assay Kit for protein quantification. Aliquots of lysate were mixed with 5× loading buffer containing 2-mercaptoethanol and boiled at 100°C for 5 min. Protein samples were separated on 12% sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gels before transferring to polyvinylidenedifluoride (PVDF) membranes. Membranes were blocked with 5% non-fat milk powder for 1 h, and then incubated with various antibodies: GR (1:1500), HDAC5 (1:500), SF1 (1:1000), StAR (1:1000), or GAPDH (1:1000) respectively. After washing with TBST three times, the membranes were incubated with horseradish peroxidase (HRP) conjugated secondary antibodies (1:10000). The protein bands were visualized by using the ECL Plus Kit. Signals of antibody binding were detected by Chemi-doc Image Analyzer (Bio-Rad, Hercules, California). Relative protein level was normalized to GAPDH values and compared to controls.
2.8 Immunofluorescence analysis
Following 48 h treatment as described above, cells were washed with ice-cold PBS for three times, fixed in 4% formaldehyde, and blocked for 30 min with 3% of bovine serum albumin (BSA) and 2% of fetal bovine serum in 0.2% Triton X-100/PBS. The cells were then incubated overnight at 4°C with primary antibodies in blocking buffer, include mouse anti-HDAC5 (1:1000 dilutions) and rabbit anti-GR (1:500 dilutions). The cells were washed with PBS and incubated with 1:100 diluted 1:100 diluted FITC-conjugated secondary antibody (GB22301, Servicebio Inc., Wuhan, China) corresponding to anti-GR or anti-HDAC5 for 60 min at room temperature. Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI) at 1:500 dilution for 5 min. The slides were washed twice with PBS. Negative controls obtained by omitting primary antibody showed negligible background fluorescence. Fluorescence images for GR and HDAC5 were captured using an immunofluorescence microscopy (Nikon H550S, Tokyo, Japan).
2.9 Co-immunoprecipitation (Co-IP)
Co-IP of proteins was performed with Protein G Magnetic Beads (Millipore, 16–157) following the manufacturer’s instructions. After several washes using ice-cold PBS, 1 ml precooled lysis buffer was added into the cell culture flask for 30 min. The suspension was then centrifuged at 12,000 rpm, 4°C for 15 min. After that, 50 µl of the supernatant was used as input protein. The other was divided into 400 µl per Eppendorf tube and added with 1 µg GR or HDAC5 antibody or a normal IgG of the same species as the negative control and incubated overnight at 4°C. After that, 40 µl of Protein G Magnetic Beads was added into the above mixture and incubated for 1 h at 4°C. The beads-antibody-antigen complexes were collected by centrifugation and washed with lysis buffer for three times. And then, 30 µl loading buffer was added to each sample following with water bath at 100°C. Western blotting analysis was used to detect the protein level.
2.10 Chromatin immunoprecipitation-polymerase chain reaction (ChIP-PCR)
ChIP assays were performed on adrenal tissues and scraped cells to evaluate the levels of GR-SF1 binding and acetylation of histone 3 Lysine 9, 14 and 27 (H3K9ac, H3K14ac and H3K27ac) at promoter region of SF1 (rat and human) gene according to a modified version of the manufacturer’s protocol. The samples were cross-linked with 1% formaldehyde on a rocker for 10 min and added 125 mM glycine to stop the reaction. The samples were then centrifuged and resuspended in 0.5 ml lysis buffer containing protease inhibitors. Cell lysates were sonicated to shear DNA to lengths of approximately 200 base pairs and transferred to a new tube with ChIP dilution buffer. Chromatin was incubated overnight at 4°C on nutator/rocker with specific antibody (1:50 dilution) for GR, H3K9ac, H3K14ac, H3K27ac, IgG and BSA-treated Protein G beads to reduce nonspecific background binding. The immunoprecipitated DNA-protein complex with beads was collected by centrifugation and washed sequentially with low-salt, high-salt, LiCl immune complex, and Tris-EDTA washing buffer solutions. Freshly prepared elution buffer (1% SDS, 0.1 M NaHCO3) was used to elute the DNA protein complex. The samples were then placed in 65°C water baths overnight to reverse formaldehyde cross-linking and subsequently were purified using DNA purification kits. Gene enrichment was quantified relative to input controls by RT-qPCR using primers specific for the promoter region [23]. The primers used are shown in Supplemental Table 2.
2.11 Human subjects, blood collection and PBMC isolation
This study was approved by the Research Committee for Human Subjects, Zhongnan Hospital of Wuhan University, China (No: 2018050). A retrospective study was conducted with medical records of pregnant women and their neonates from June 1 to December 1, 2017. The following criteria were required for the inclusion: ① neonates who need admission to the neonatal intensive care unit; ② pregnancies who were received one course of dexamethasone treatment between gestation week (GW) 34 to GW42 and delivered after 24 h to 7 days; or ③ received one course of dexamethasone treatment at GW23 to GW 33 and delivered after 24 h to 7 days; ④ pregnancies who delivered between GW23 to GW42 without administration of dexamethasone. Sixty male neonates recruited in this study were categorized into two groups: control group without dexamethasone administration and dexamethasone group with single dose of treatment. Demographic and pregnancy characteristics of recruited subjects were collected, the detail information is shown in Table 3. We compared maternal age, gestational age, birth weight of neonates and Apgar score of 1 min and of 5 min between two groups. Apgar score can describe the condition of the newborn infant and, when properly applied, as a tool to predict infants’ outcome. To avoid disturbance of the diseases and multiple pregnancies to the results, pregnant women with abnormal liver function or hereditary metabolic diseases were excluded. All of the donors or their guardians provided written consent and ethics permission was obtained for the use of all samples. Blood samples (2–3 mL) were obtained with ethylenediaminetetraacetic acid (EDTA) vacutainers within 6 h after birth, and PBMC were immediately isolated via Ficoll-Paque (catalog no. 17-1440-02, GE) separation. All analyses described below were run in individual samples.
Table 3
Characteristics of enrolled human subjects.
Indexes | Control (n = 38) | ADT (n = 22) | P value |
Maternal age (year) | 31.74 ± 0.86 (22–47) | 32.55 ± 0.10 (25–43) | 0.533 |
Gestational age (week) | 34.40 ± 0.27 (31-36.71) | 34.03 ± 0.34 (31.29–36.43) | 0.399. |
Birth weight (g) | 2208.68 ± 62 (1500–2910) | 2120 ± 111 (960–3250) | 0.453. |
Apgar scores (1 min)a | 7.76 ± 0.12 (6–9) | 7.68 ± 0.17 (6–9) | 0.692. |
Apgar scores (5 min)a | 8.79 ± 0.12 (7–10) | 8.77 ± 0.16 (7–10) | 0.993 |
ADT, antenatal dexamethasone treatment. a Values are presented as median (interquartile range); N.S.: No significance.
2.12 Statistical analysis
Prism 6.0 (GraphPad Software, La Jolla, CA, USA) was used to perform data analysis. All presented measurement data were expressed as the mean ± S.E.M. and was evaluated with Independent Samples t-test for comparison between two groups or with one-way ANOVA followed by a post hoc Dunnett t-test for comparison among multiple groups. Statistical significance was set at P < 0.05.