Clinical cohorts:
Patients enrolled in the initial clinical trial cohort were as previously described1. Briefly, patients ≥18 years old with histologically-proven clinical stage III or oligometastatic stage IV BRAFV600E/K melanoma deemed resectable by multidisciplinary consensus and measurable disease by RECIST 1.1 criteria were enrolled and those randomized to the experimental arm received 8 weeks of neoadjuvant dabrafenib (150mg PO BD) plus trametinib (2mg PO daily) prior to surgical resection, followed by up to 44 weeks of adjuvant dabrafenib and trametinib (neoDT)(n=12). Additional patients (n=20) from a single-arm study of neoDT along with an additional retrospective cohort of patients treated off protocol for logistic reasons with neoDT (n=16), Dabrafenib (n=3), and Encorafenib plus Binimetinib (n=1) were included. Radiographic responses to neoadjuvant therapy were determined at week 8 prior to surgery and pathologic responses were determined by microscopic examination of the complete surgical specimen by a melanoma pathologist, including SOX10 immunostains when applicable to confirm presence or absence of viable melanoma cells.
RNA sequencing:
Tumor biopsies were obtained as feasible by punch or core biopsy prior to and during the neoadjuvant treatment period. Fresh-frozen tumor biopsy material was used for RNA sequencing library preparation. Total RNA was extracted from snap-frozen tumor specimens using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen) following assessment of tumor content by a Pathologist, and macrodissection of tumor bed if required. RNA quality was assessed on an Agilent 2100 Bioanalyzer using the Agilent RNA 6000 Nano Chip with smear analysis to determine DV200 and original RNA concentration. Based on RNA quality, 40-80ng of total RNA from each sample then underwent library preparation using the Illumina TruSeq RNA Access Library Prep kit according to the manufacturer’s protocol. Barcoded libraries were pooled to produce final 10-12 plex pools prior to sequencing on an Illumina NextSeq 500 sequencer using one high-output run per pool of 76bp paired-end reads, generating 8 fastq files (4 lanes, paired reads) per sample.
RNA sequencing data processing:
RNA-seq FASTQ files were first processed through FastQC (v0.11.5)2, a quality control tool to evaluate the quality of sequencing reads at both the base and read levels. Reads having ³15 contiguous low-quality bases (phred score <20) were removed from the FASTQ files prior to STAR 2-pass alignment (v2.5.3)3 with default parameters to generate one BAM file for each sequencing event. After that, RNA-SeQC (v1.1.8) 4 was used to generate quality control metrics including read counts, coverage, and correlation. A matrix of Spearman correlation coefficients amongst all sequenced samples was subsequently generated by RNA-SeQC and after careful review the sequencing data generated from one library pool that showed poor correlation with other library pools from the same RNA sample was removed before sample-level merging of BAM files.
HTSeq-count (v0.9.1)5 tool was applied to aligned RNA-seq BAM files to count how many aligned reads overlapped with the exons of each gene. The raw read counts generated from HTSeq-count were normalized into fragments per kilobase of transcript per million mapped reads (FPKM) using the RNA-seq quantification approach suggested by the bioinformatics team of NCI Genomic Data Commons (GDC) [https://docs.gdc.cancer.gov/Data/Bioinformatics_Pipelines/Expression_mRNA_Pipeline/]. Briefly, FPKM normalizes read count by dividing it by the gene length and the total number of reads mapped to protein-coding genes using a calculation described below:
RCg, number of reads mapped to the gene; RCpc: number of reads mapped to all protein-coding genes; L, length of the gene in base pairs (calculated as the sum of all exons in a gene). The FPKM values were then log2-transformed for further downstream analyses.
RNA sequencing differential expression and gene set enrichment analysis:
The HTSeq normalized read count data for all expressed coding transcripts were processed by DESeq2 (v3.6)6 software to identify differentially expressed genes (DEGs) between two response (responder vs. non-responder) groups. A cut-off for gene expression fold change of ≥2 or ≤-0.5 and a FDR (q-value) of <.05 was applied to select the most differentially expressed genes. Gene set enrichment analyses were performed using the GSEA software developed at the Broad Institute, using vst-normalised7 input transcriptome expression data and querying the MSigDB Hallmark gene sets with default parameters.
Animals and xenograft studies:
Female or male C57BL/6 (strain code: 0000664, purchased from Jackson Lab), aged 6 to 12 weeks, and weighing approximately 20 to 25 g were used for in vivo studies. Female or male CD-1 nude mice (strain code: 086, purchased from Charles River Laboratories), aged 6 to 12 weeks, and weighing approximately 25-40 g were used for the immunodeficient model in vivo studies. Animal health was monitored daily by observation and sentinel blood sample analysis. Animal experiments were conducted in accordance with the Guideline of IACUC at MDACC.
BP cells were scaled up in DMEM culture media supplemented with 10% FBS, harvested, and prepared so that each mouse received 0.8x106 cells in 0.2 mL PBS. Cells were implanted subcutaneously in the right flank of each mouse. For some male mice, physical castration was required and performed two weeks before treatment or before cell implantation. Testosterone pellets (Innovative Research of America) were implanted subcutaneously in the left flank one week before treatment. Trametinib (Chemietek) at 1 mg/kg and Dabrafenib (Chemietek) at 30 mg/kg were suspended at concentrations as needed in an aqueous vehicle containing 0.5% Hydroxypropylmethylcellulose and 0.2 % Tween 80 in distilled water and adjusted to pH 8.80 with diluted NaOH solution. Enzalutamide (Chemietek) at 10 mg/kg was suspended in 1% carboxymethyl cellulose (Sigma), 0.1% Tween-80, 5% DMSO.
BP tumors were monitored by caliper before randomly sorting and dividing into experimental groups (n=10 mice per group). Treatment was started from day 14 to 17 days post-implantation depending on mouse strain and gender. Vehicle controls, mixture of Trametinib at 1 mg/kg and Dabrafenib at 30 mg/kg or Enzalutamide at 10 mg/kg were given orally using a sterile 1- mL syringe and 18-gavage needle for 21 days. Dosing was 5 hours apart between administration of Trametinib + Dabrafenib and Enzalutamide for these specific treatment groups.
Tumor volume was calculated using the following formula: [L X (W2)/2] (in which L + length of tumors; W =width of tumor). Tumor and plasma were harvested 4 hours after the last dose. Tumors were snap of frozen and the plasma was divided for monitoring drug concentrations and hormone levels. Endpoint samples were collected and processed for gene expression using Quant-seq and protein expression via Reverse Phase Protein Array (RPPA). RPPA analysis was performed at the MD Anderson Cancer Center’s functional proteomic RPPA core facility as previously described8.
Quant-seq library construction and sequencing.
1000 ng or 500 ng of DNAse-treated RNA samples were converted to cDNA using a QuantSeq 3’ mRNA according to the manufacturer's protocol (Lexogen, Vienna, Austria). The libraries were amplified with 12 or 13 PCR Cycles and purified using the provided Lexogen. The purified libraries were quantified using a Kapa library quantification kit (KAPA biosystems) and loaded on NextSeq 500 Sequencer (Illumina, San Diego, CA) at a final concentration of 2.6 pM to perform cluster generation, followed by 1x76 bp sequencing on NextSeq 500 Sequencer (Illumina).
Androgen Receptor CRISPR KO in BP cell lines:
Three guide sequences were designed to target a 100 bp region of Exon 1 using HorizonDiscovery’s CRISPR Design Tool. Guide 1 (gacttgggtagtctacatgg AGG) was cloned into pLentiCRISPR.v2 according to addgene lentiCRISPRv2 and lentiGuide oligo cloning protocol for the purpose of pool selection. Guide 2 (gcttgatacgggcgtgtggat GGG) and Guide 3 (ctggagaacccattggacta CGG) were ordered as crRNA’s (IDT).
The Neon electroporation system was used to transfect ribonucleoprotein (RNP) complex + plasmid into the BP cells. The crRNAs were rehydrated to 200 nM and pooled in equal volume (3 µL each) for annealing with Alt-R CRISPR-Cas9 tracrRNA-ATTO 550 (IDT; 1075928); 95°C x 5 min, slowly cool to 10°C at 0.1C/sec. 5 µL of crRNA:tracrRNA were combined with 5 µL of Alt-R S.p. HiFi Cas9 nuclease (IDT; 1081060) at room temperature for 10 min to generate the RNP complex. Electroporation Enhancer (2 µL) (IDT; 1075916) and 2 µg of plasmid were added to the RNP. During the annealing reaction, 1x106 BP cells were pelleted at 600xg for 3 min. The total volume of RNP + Plasmid + Electroporation Enhancer was transferred to an aspirated cell pellet. Next, 95 µL of R buffer was added to the cells and they were gently resuspended to single cells for an immediate 100 µL electroporation reaction. The Neon settings for the BP cells were two 30 ms pulses at 1150 volts. The cells were transferred to a single well of a 6 well plate and allowed to recover in growth media. After 24 hrs, the media was replaced and 1.5 µg/µL of Puromycin for a 48-hr selection. The cells were allowed to recover from selection for 48 hrs before single-cell clone selection. After clones were selected and expanded, AR protein was analyzed by Western Blot to confirm AR knockout. Briefly, cells were lysed for 30 min at 4 °C in 150 µL RIPA buffer with phosphatase and protease inhibitors. Protein (15 µg) was run on 10% SDS Page (Bio-Rad) and transferred overnight onto PDF membranes using TRIS Glycine Methanol buffer. After blocking for 1 hour at room temperature in 5% milk diluted in TSBS-T, AR antibody (Abcam) was incubated at 1:2000 dilution for 24 hrs. GAPDH was used as a loading control. The lentiviral expression vectors pLV-105 were purchased from Genecopeia to express either GFP as a transduction control or mouse Ar (NM_013476.3) for an overexpression control. Lentivirus was generated using standard protocols and psPAX2 and pMD2.G as the packaging vectors. BP cells were transduced at 90% efficiency with viral supernatant and selected for 48 hours with 2 µg/mL puromycin.
Measuring testosterone levels from plasma:
Testosterone quantification was determined using Agilent’s UHPLC Infinity II and 6495 triple quadrupole mass spectrometer, and MassHunter workstation software (8.0.8.23.5). Briefly, plasma samples were extracted with tert-butyl methyl ether (Sigma 34875), dried, and derivatized using hydroxylamine hydrochloride (Sigma 431362). The recovered ketoxime steroids were reconstituted in methanol/water (1:1 v/v) and injected into the Infinity II UHPLC. Ketoxime steroids were separated using a Chromolith reverse phase column (RP-18 endcapped 100-2mm, Sigma 152006) and introduced into a JetStream source (Agilent) for triple quadrupole analysis. Data were analyzed and quantified using MassHunter software (Agilent) and GraphPad PRISM 8 software was used to graph and perform statistics (two-sided Students t-test)9,10.
Immunofluorescence
FFPE blocks were sectioned (5 μm), mounted on charged microscope slides (Leica 38002092), and dried at 37°C overnight. Slides were then baked at 60°C for 1 hour in an oven (Biocare DRY2008US), deparaffinized in 3 changes of xylene, and then rehydrated in 3 changes of 100% ethanol followed by a series of 95%, 70%, and 50% ethanol and distilled water (5 min. each). Antigen retrieval (10 mM sodium citrate, pH 6.0 with 0.05% Tween 20) was performed by heating slides to 95°C for 15 minutes in a microwave (Biogenex EZ Retriever System v.3) followed by a 30 minute cool down at room temperature. Slides were then washed with TBST (Thermo TA-999-TT). The area around each section was traced with a PAP pen (Sigma Aldrich Z672548), blocked with Background Sniper (Biocare BS966) for 10 minutes, and then washed with TBST.
Primary antibody (rabbit anti-Androgen Receptor [EPR1535(2)], Abcam ab133273, 1:300, diluted in Dako S3022) was incubated overnight at 4°C, followed by a TBST wash. Secondary antibody (goat anti-rabbit Alexa-647 conjugate, Thermo A32733, 1:400, diluted in Fluorescence antibody Diluent, “FAD”, Biocare FAD901L) was added and allowed to incubate for 1 hour at room temperature, followed by a TBST wash. A sequential incubation with fluorophore-conjugated primary antibody was performed (rabbit anti-Sodium Potassium ATPase [EP1845Y] Alexa-488 conjugate, Abcam ab197713, 1:500, were diluted in FAD) for 1 hour at room temperature, followed by a TBST wash. Finally, slides were incubated with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride (5 mg/mL stock in DMF, Thermo D1306) at 0.25 μg/mL (diluted in TBST) for 10 minutes at room temperature. Slides were then washed with a series of TBST, followed by TBS and then distilled H2O. Excess liquid was removed and slides were mounted with ProLong Diamond Gold (Life Tech P36930) and allowed to harden overnight. For patient samples, a TSA-amplification of AR signal was performed. Briefly, following antigen retrieval/tissue tracing with PAP pen, performed as above, slides were incubated with treated with Bloxall to remove endogenous peroxidase (Vector Labs SP-6000) for 10 minutes at RT. Slides were then rinsed in water (30 seconds) and TBST (30 seconds). Slides were blocked with 2.5% Normal Horse Serum (Vector Labs MP-7401 Component) for 25 minutes at RT and then block was tapped off. Slides were then blocked with Opal-specific PE/Diluent/Block (AKOYA ARD1001EA) for 10 minutes at RT and then block was tapped off. Primary antibody (rabbit anti-Androgen Receptor [EPR1535(2)], Abcam ab133273, 1:300, diluted in PE Diluent AKOYA ARD1001EA) was incubated O/N at 4°C, followed by a TBST wash for 3 minutes. Anti-Rabbit secondary HRP polymer was then added to slides (Impress MP-7401) for 25 minutes at RT after which slides were washed in TBST. Opal signal was generated by adding Opal 570 fluorophore (AKOYA FP1488001KT diluted 1:200 in 1x Plus Amplification Diluent AKOYA FP1609) for 10 minutes at RT and then washed in TBST. All following steps e.g. staining with the membrane marker (Abcam ab197713), DAPI, and coverslip mounting were identical to the steps described above.
IF Image acquisition and Analysis
Slides were imaged on a Vectra 3 using the A UPlanSApo 10x/0.40 air objective first. Images were acquired using all available channels with the Vectra software (3.0.5) and the raw data was saved as “.qptiff” files. Regions of interest (ROIs) were created using PhenoChart (1.0.10) and these areas were then imaged again at 20X magnification on the Vectra. 20x images were then spectrally unmixed using inForm software and saved as Component TIFFs. The patient samples were imaged on a Vectra Polaris at 10x and saved as “.qptiff” files. Files were opened in QuPath software, channels were split, and saved individually (or merged) as TIFFs. An APP was created in Visiopharm to segment cells and assess intensity of AR immunofluorescence. Percent positive cells was calculated for each sample. Raw analyzed data was exported as a.CSV file and graphed/statistics run using GraphPad PRISM 8 software. A t-test test was performed to test significance.
Methods References
1 Amaria, R. N. et al. Neoadjuvant plus adjuvant dabrafenib and trametinib versus standard of care in patients with high-risk, surgically resectable melanoma: a single-centre, open-label, randomised, phase 2 trial. Lancet Oncol 19, 181-193, doi:10.1016/S1470-2045(18)30015-9 (2018).
2 FastQC: A Quality Control Tool for High Throughput Sequence Data [Online] (2010).
3 Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21, doi:10.1093/bioinformatics/bts635 (2013).
4 DeLuca, D. S. et al. RNA-SeQC: RNA-seq metrics for quality control and process optimization. Bioinformatics 28, 1530-1532, doi:10.1093/bioinformatics/bts196 (2012).
5 Anders, S., Pyl, P. T. & Huber, W. HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics 31, 166-169, doi:10.1093/bioinformatics/btu638 (2015).
6 Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550, doi:10.1186/s13059-014-0550-8 (2014).
7 Huber, W., von Heydebreck, A., Sultmann, H., Poustka, A. & Vingron, M. Variance stabilization applied to microarray data calibration and to the quantification of differential expression. Bioinformatics 18 Suppl 1, S96-104, doi:10.1093/bioinformatics/18.suppl_1.s96 (2002).
8 Tibes, R. et al. Reverse phase protein array: validation of a novel proteomic technology and utility for analysis of primary leukemia specimens and hematopoietic stem cells. Mol Cancer Ther 5, 2512-2521, doi:10.1158/1535-7163.MCT-06-0334 (2006).
9 Efstathiou, E. et al. Enzalutamide in Combination with Abiraterone Acetate in Bone Metastatic Castration-resistant Prostate Cancer Patients. Eur Urol Oncol 3, 119-127, doi:10.1016/j.euo.2019.01.008 (2020).
10 Maity, S. N. et al. Targeting of CYP17A1 Lyase by VT-464 Inhibits Adrenal and Intratumoral Androgen Biosynthesis and Tumor Growth of Castration Resistant Prostate Cancer. Sci Rep 6, 35354, doi:10.1038/srep35354 (2016).