2.1 Patients and tissue specimens
Tissue samples were tested and verified as CRC or adjacent normal tissue by two independent pathologists, and the CRC samples were staged based on the 8th edition of the American Joint Committee on Cancer (AJCC) Cancer Staging Manual. This study was approved by the Ethics Committee of the Tianjin Medical University Cancer Institute and Hospital (Approval No. bc2020073) and was consistent with the ethical guidelines of the Helsinki Declaration and approved by the Ethics Committee.
2.2 Cell culture
SW480 and HCT8 cells were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Due to culture requirements (37 °C, 5% CO2), the two cell lines were cultured in complete DMEM (Corning, New York, USA) supplemented with a 1% penicillin-streptomycin solution (PS; HyClone, Logan, Utah, USA) and 10% fetal bovine serum (FBS; PAN-Seratech, Edenbach, Germany).
2.3 Cell transfection
To acquire lentiviral particles, expression plasmids (sh-Ctrl and sh-PLK4) and packaging plasmids (VSVG and ΔR) were transfected into HEK293T cells supplemented with PEI (Polysciences, Warrington, USA). SW480 and HCT8 cells were used for transfection. Polybrene (Solarbio, Beijing, Chia) was applied as the transfection reagent. Stably transfected SW480 and HCT8 cell lines were obtained under puromycin (Gibco, New York, USA) selection.
2.4 Immunohistochemical staining
Immunohistochemistry (IHC) was applied to assess the protein level of PLK4 in paraffin-embedded samples of CRC tissue according to previously described methods[23]. An anti-PLK4 antibody was used at the concentration of 1:200 (Abcam, Cambridge, UK). The IHC score was used to examine the correlation between PLK4 expression and OS in CRC patients. In CRC patients, the IHC score was also used in correlation analysis for some clinicopathological factors. The percentage of PLK4-positive cells was evaluated from 0 to 3 (0, no positive cells; 1, < 30% positive cells; 2, 30–60% positive cells; and 3, 60%-100% positive cells). The PLK4 staining intensity was scored across a range of four grades (0, no positive staining; 1, weakly positive staining; 2, moderately positive staining; and 3, strongly positive staining). Finally, the IHC staining intensity and percentage scores were integrated to calculate the IHC score.
2.5 RNA extraction, cDNA synthesis, and qRT-PCR
Total RNA was separated from adherent cells with TRIzol reagent (Ambion, Texas, USA). According to a qRT-PCR kit (Takara, Tokyo, Japan), cDNA was synthesized by reverse transcription of the isolated RNA. The amplification reaction was executed with designed primers based on the manufacturer's instructions (Takara). The primer sequences are shown in Table 1.
Table 1
The primer sequences in this manuscript
|
F-primer
|
R-primer
|
PLK4
|
GTACGATTCTGATAACCCC
|
GGGGTTATCAGAATCGTAC
|
MKI67
|
CTGACCCTGATGAGAGTGAGGG
|
TCTCCCCTTTTGAGAGGCGT
|
P15
|
TGGGGTGGGAAAGTGGATTGCA
|
CCCAGTGCAGAGGTGTTCAGGTCT
|
P16
|
GCTGCTCACCTCTGGTGCCAAA
|
ACCTGCGCACCATGTTCTCG
|
P27
|
GGTTAGCGGAGCAATGCGCA
|
AACCGGCATTTGGGGAACCGTC
|
LRG1
|
GGGTCAGAACCAAGGGGTTT
|
GTCACAGGCCATTGATCCCA
|
BMP7
|
ACGAGGTGCACTCGAGCTT
|
GAAGCGTTCCCGGATGTAGT
|
GAPDH
|
TGGTATCGTGGAAGGACTCA
|
CCAGTAGAGGCAGGGATGAT
|
2.6 WB and antibodies
The following antibodies were used: anti-PLK4 (1:1,000), anti-CCNE1 (1:1,000), anti-PCNA (1:1,000) and anti-vimentin (1:8,000) from Abcam, anti-N-cadherin (1:500) from Santa Cruz Biotechnology (Delaware, USA); anti-E-cadherin (1:500) from Sino Biological Inc. (Beijing, China); anti-CCND1 (1:1,000), anti-p-P38 (1:1,000), anti-P38 (1:1,000), anti-p-ERK (1:4,000) and anti-ERK (1:1,000) from Cell Signaling Technology (Danvers, USA); and anti-GAPDH from Bioss (Beijing, China). The steps for WB were based on previously described methods[23].
2.7 CCK-8 assay
According to the protocol of the CCK-8 assay, sh-PLK4- and sh-Ctrl-transfected SW480 and HCT8 cells were plated in a 96-well plate at a density of 1–4 × 103 cells per well. Six parallel wells were used for each independent group. Ten microliters of CCK-8 (Dojindo Laboratories, Kyushu, Japan) reagent was mixed in each well and incubated with the cells for 4 h at 37 °C in 5% CO2. The optical density (OD) value at 450 nm was evaluated with an enzyme-labeling instrument. Cell viability was assessed on days 0, 1, 2 and 3.
2.8 Colony formation assay
For cell proliferation analysis, sh-PLK4- and sh-Ctrl-transfected CRC cells were seeded in 6-well plates (500-1,000 cells/well) and incubated at 37 °C in 5% CO2 for 1–2 weeks. Once colonies were evident, the cells were stained with crystal violet and photographed with a digital camera.
2.9 Apoptosis analysis
CRC cells were washed with ice-cold PBS and then suspending in 200 µL of 1 × binding buffer, followed by staining for 15 minutes in the dark with Annexin V-APC (eBioscience, California, USA). Based on the cell number, 400–800 µL of 1 × binding buffer was added and mixed, and then the cells were evaluated. The percentage of apoptotic cells was assessed with thecc (Millipore, Massachusetts, USA).
2.10 Cell cycle assay
CRC cells were digested, mixed in 95% ethanol and incubated at 4 °C overnight. Following centrifugation and washing, the cells were incubated with 500 µL of propidium iodide (PI; BD Biosciences, New Jersey, USA) and stained in the dark for 15 minutes. The cell samples were assessed on a FACS Aria flow cytometer (BD) with CellQuest software, and the results were evaluated with FlowJo software.
2.11 Scratch assay
CRC cells were harvested at a concentration of 1.5-2 × 106 cells per well in 6-well plates. The next day, an equal-width scratch was made through the CRC cell monolayer in the 6-well plates by using a 2.5-µL pipette tip. Then, the cells were washed with PBS two or three times, and 2% FBS was mixed into the unsupplemented DMEM. The healing of the scratch was recorded by assessing the reductions in the distance between the edges measured at a suitable time (3, 6, 9, 12, or 24 h) and comparing those distances with the average distance measured at six stochastic locations at 0 h. Images were captured at 0 and 24 h with a microscope at 10 × magnification. Data are shown as the mean ± SD.
2.12 Migration and invasion assays
For the migration and invasion assays, DMEM supplemented with 20% FBS was loaded into the lower chamber of a transwell system. A total of 1 × 105 cells in 2% FBS DMEM were plated on an 8-µm polyvinyl pyrrolidone-free polycarbonate filter membrane (Corning) for the migration assay. For the invasion assay, Matrigel-coated transwell chambers were incubated for more than 1 h at 37 °C. After incubating for approximately 24 h at 37 °C in 5% CO2, the migrated or invaded cells on the bottom were fixed with 4% paraformaldehyde (PFA) for 20 minutes and stained.
2.13 Immunofluorescence
In total, 3 × 104 cells were plated in each well of 12-well plates containing sterile coverslips. The following day, PBS was used to wash the coverslips. The cells were fixed with 4% PFA for 15 minutes, permeabilized in 0.25% Triton X-100 for 5 minutes and blocked in 3% BSA for 1 h, all at ambient temperature. After incubation with primary antibodies at 4 °C overnight, the cells were stained with Alexa Fluor 488-conjugated or Alexa Fluor 546-conjugated secondary antibodies (Invitrogen, California, USA) separately at room temperature for 1 h in the dark. 4’,6-Diamidino-2-phenylindole (Roche, Basel, Switzerland) staining of cell nuclei was then performed. Then, we captured images with a confocal laser scanning microscope (Olympus FV1000, Japan).
2.14 In vivo experiments
Four- to five-week-old nude mice (SPF Biotechnology Co., Ltd., Beijing, China) were acquired for xenograft animal assays (n = 8 per group). sh-Ctrl/SW480 and sh-PLK4/SW480 cells were prepared, and 5 × 106 cells in 100 µL of PBS were injected subcutaneously. Tumor volume was measured every three days using a Vernier caliper. To establish lung metastasis models, prepared sh-Ctrl/SW480 and sh-PLK4/SW480 cells (5 mice/group, 2 × 106/mL; 100 µL per mouse) were injected into the tail vein. After six weeks, the mice were sacrificed, and the lungs were harvested. The harvested lung tissues were fixed with formalin and embedded in paraffin. The tissues were used for hematoxylin and eosin (H&E) staining.
2.15 The Cancer Genome Atlas and Gene Expression Omnibus datasets
Raw data from The Cancer Genome Atlas (TCGA; National Cancer Institute) and Gene Expression Omnibus (GEO; NCBI) databases for CRC were downloaded from the official database websites. Then, the original data were normalized with R Studio. We evaluated the expression of PLK4 in tumor, adjacent normal tissue and polyp tissue samples from the TCGA, GSE41657 and GSE41258 mRNA expression datasets.
2.16 Gene set enrichment analysis
Gene set enrichment analysis (GSEA) was used to evaluate whether the PLK4 mRNA level was correlated with CRC biological features and signaling pathways, including tumor metastasis, proliferation, invasiveness, cell cycling, EMT and patient survival, on the basis of the GSE32323 dataset for CRC evaluated with GSEA 4.0.0 (The Broad Institute of MIT and Harvard).
2.17 Statistical analyses
Clinical data were processed and assessed by using SPSS 24.0 for Windows (SPSS Inc., Chicago, IL). The univariate Kaplan-Meier method and multivariate Cox method were used to evaluate the independent risk factors and survival curves of CRC patients. Spearman correlation analysis was used to examine the correlations between the PLK4 staining score and clinicopathological factors.