Dexmedetomidine Protects against Hepatic Ischemia-Reperfusion Injury by inhibiting Endoplasmic Reticulum Stress and Cell Apoptosis in Rats

doi:10.21203/rs.3.rs-601634/v1

Download PDF

Research Article

Dexmedetomidine Protects against Hepatic Ischemia-Reperfusion Injury by inhibiting Endoplasmic Reticulum Stress and Cell Apoptosis in Rats

https://doi.org/10.21203/rs.3.rs-601634/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Hepatic ischemia-reperfusion injury (IRI) remains a major complication of liver surgery, dexmedetomidine (DEX) has a certain protective effect on liver during ischemia-reperfusion, but the underlying mechanisms are not fully understood. This study explored the protective effects of DEX and investigated whether DEX protects against hepatic IRI by inhibiting endoplasmic reticulum stress (ERS) and its downstream apoptotic pathway in a rat model.

Methods: Thirty-six male Sprague-Dawley (SD) rats were divided into six groups: S, IR, DL, DM1, DH and DM2 group. Group S was subjected to laparotomy, and exposure of the portal triad without occlusion. I-R injury model was induced by clamping the portal vessels supplying the middle and left hepatic lobes for 30 min in IR, DL, DM1, DH and DM2 group. Then DL, DM1, DH group received DEX of 25 μg/kg, 50 μg/kg and 100 μg/kg intraperitoneally at 30 min before ischemia, respectively, DM2 group received 50 μg/kg DEX intraperitoneally 30 min after reperfusion, and IR group received normal saline. After 6 h of reperfusion, assessment of liver function, histopathology, oxidative stress was performed. The liver cell microstructure was detected by transmission electron microscopy. Hepatocyte apoptosis was determined by TUNEL assay. Real-time PCR, Western blotting were performed to analyze various ERS molecules.

Results: We observed that DEX protected the liver by alleviating hepatocytes damage, reducing the content of ALT and MDA, increasing the activity of SOD, reducing the number of TUNEL-positive cells, down-regulating the expression of GRP-78, PERK, ATF-6, Caspase-12 mRNA, and p-PERK, p-IRE-1 α, CHOP proteins, up-regulating Bcl-2 protein. The effect of 50 μg/kg DEX is superior to 25 μg/kg DEX, but not significantly different from 100μg/kg DEX. There was no significant difference in the above monitoring indexes between DM1 and DM2 group.

Conclusions: DEX protects the liver from IRI by inhibiting ERS and cell apoptosis. The protective effect of DEX was dose-dependent in a certain dose range, both DEX administered prior to ischemia and following reperfusion markedly reduced liver injury induced by hepatic IRI in mice.

Molecular Genetics

Molecular Biology

Internal Medicine

Dexmedetomidine

Ischemia-reperfusion

Liver

Apoptosis

Endoplasmic reticulum stress.

Ischemia reperfusion injury (IRI) takes place when blood provision to an organ is diminished or interrupted, the restoration of blood reperfusion will aggravate the damage of the physiological function, structure, and metabolism of the organs. Hepatic IRI remain a major complication of severe liver trauma, hemorrhagic shock, liver transplantation and partial hepatectomy ^{[1, 2]}. Especially with the improvement of surgical technology and equipment, more and more liver operations are carried out. However, hepatic IRI remain one of the main factors that deteriorate morbidity and mortality of the liver surgery ^[3]. Hepatic IRI has become a major obstacle in the development of liver surgery. Therefore, to find effective measures to prevent and avoid hepatic IRI have become one of major clinical problems.

Apoptosis, a physiological mechanism of organisms, plays an extremely important role in maintaining the stability of internal environments. During hepatic IRI for the first 24 hours after reperfusion, apoptosis is one of the main hepatocytes’death modes ^[4]. Thus, we speculated that regulation of key apoptosis-related proteins expression is an important protective mechanism for the attenuation of hepatic IRI. So far, the apoptotic pathway is known to include the death receptor-mediated pathway, the mitochondrial pathway, and the endoplasmic reticulum stress (ERS) pathway.

Endoplasmic reticulum (ER) is an important membranous organelle which is responsible for protein synthesis, folding and secretion. Previous studies have demonstrated that ERS is involved in the pathogenesis of many diseases, including liver diseases ^{[5, 6]}. Hepatic IRI induces ischemia, hypoxia, Ca²⁺ homeostasis, oxidative stress, and elevates protein secretion, which triggers the disruption of ER internal balance ^[7]. The disturbances of ER function cause ERS, which subsequently leads to the unfolded protein response (UPR). The UPR initially activates three major signal transducers, protein kinase R-like ER kinase (PERK), activating transcription factor 6 (ATF6), and inositol-requiring enzyme 1 (IRE1). However, excessive or prolonged ERS leads to the expression of apoptotic signaling pathways. Activation of C/EBP homologous protein (CHOP) is the main pathway for apoptosis in ERS downstream ^[8]. During this process, caspase-12 and JNK are also activated and involved in ERS cell apoptosis pathway ^[9]. Literature show that hepatic IRI is closely related to ERS and apoptosis, many studies have confirmed inhibiting the ERS response pathways can effectively alleviate hepatic IRI^[10–12]. Thus, strategies targeting ERS may have potential protective roles in hepatic IR injury.

Among the therapeutic intervention strategies, pharmacologic strategies have been demonstrated to play an important role in protecting livers against IR injury ^[13]. Dexmedetomidine (DEX) is a selective and potent α2 adrenergic receptor agonist with a good sedative effect and no respiratory depression, and is mainly used in clinical anesthesia and ICU sedation. Recently, it has been reported that DEX has other possible applications ^[14]. At the same time, there is a large literature showing that DEX exerts various pharmacological effects, such as anti-inflammation ^[15], anti-oxidant ^[16], and anti-apoptosis ^[17]. Accumulationg evidence suggested that DEX has a protective effect on ischemia-reperfusion injury of the heart, kidney, and other organs ^{[8, 18]}. However, its specific mechanism has not been clarified. DEX shows different functions in the protective effect of hepatic IRI. Zong et al. have confirmed that DEX pre-treatment can suppress oxidative stress, decrease NLRC5 expression through inactivating NF-kB pathway ^[16]. It has also been reported that DEX preconditioning inhibited intrahepatic proinflammatory innate immune activation by promoting macrophage M2 activation in a PPARγ/STAT3 dependent manner ^[19]. In addition, DEX has been shown to protect the liver against IR injury via the suppression of the TLR4/NF-kB pathway ^[20]. However, the contribution of ERS-induced apoptosis remains unknown.

Therefore, this study is aimed to explore the protective effects of DEX and investigate whether DEX protects against hepatic IRI by inhibiting ERS in a rat model.

Animals and Hepatic I-R Model

Thirty-six male SD rats were obtained from the Animal Center of Hebei medical University (Shijiazhang, China). Rats weighed 180-220g and were raised under a steady temperature around 20˚C with 12 h light–dark cycles for one week to adapt to the environment. The experimental protocol was approved by the Agricultural University of Hebei Ethical Committee, Baoding, China.

70% Hepatic I-R model was performed according to previous studies ^[21]. An atraumatic clip was applied to the portal vessels to induce ischemia of the middle and left hepatic lobes under isoflurane anesthesia. The ischemia was confirmed by tissue blanching. After 30 min ischemia, the clamp was removed for reperfusion. The reperfusion was confirmed by immediate color change of the ischemic lobes after removal of the clamp.

Grouping and treatment

The rats were randomly divided into six groups (n=6) as follows:

Group S: the rats were subjected to laparotomy, and exposure of the portal triad without occlusion.
Group IR: the rats were subjected to laparotomy, and exposure of the portal triad with occlusion, and no drug was utilized.
Group DL: the rats received 20 μg/kg DEX intraperitoneal injection 30 min before ischemia of the hepatic lobes.
Group DM1: the rats received 50 μg/kg DEX intraperitoneal injection 30 min before ischemia of the hepatic lobes.
Group DH: the rats received 100 μg/kg DEX intraperitoneal injection 30 min before ischemia of the hepatic lobes.
Group DM2: the rats received 50 μg/kg DEX intraperitoneal injection 30 min after reperfusion.

Blood and tissue sample collection

After 6 h reperfusion, all rats were sacrificed to collect blood samples and parts of the IR liver (middle and left lobes). Blood samples were centrifuged at 3000 rpm for 10 min within 1 h after collection and the serum was stored at -80℃ until use. The liver tissues were rapidly separated, washed with 0.01M phosphate-buffered saline, and placed in an ice tray. The middle liver lobe was placed in 10% formalin solution and embedded in paraffin to observe pathological changes. The left lobe was stored at -80℃ for further analysis.

Biochemical Analysis

The serum sample was measured to determine the levels of alanine aminotransferase (ALT) using a UniCel DxC800 Synchron chemistry system (Beckman, USA). According to the instructions of the corresponding assay kit (Nanjing Jiancheng Bioengineering Institute, China), liver tissue was prepared into a homogenate to detect concentrations of malondialdehyde (MDA) and the activity of the antioxidant enzyme superoxide dismutase (SOD).

Histopathological Analysis

After fixation with 10% formalin solution, liver tissue samples were embedded in paraffin, sectioned to 5 μm thicknesses, and stained with hematoxylin and eosin (H&E). Histological changes were observed under a light microscope. Histopathologists with no prior knowledge of the experiment evaluated the sections at 200x magnification. Liver injury was scored on a scale of 0 to 4 for sinusoidal congestion, vacuolization of hepatocyte cytoplasm, and parenchyma, as described by Suzuki et al.^[22].

Transmission Electron Microscopy

The liver samples of each group were pre-fixed in glutaraldehyde (2.5%), washed with PBS and then fixed with 1% osmic acid for 2 h. After dehydration in gradient ethanol, the fixed samples were embedded in epoxy resin, cut into ultrathin sections (50 nm) and stained with uranyl acetate and lead citrate. The stained sections were observed using a transmission electron microscope (TEM; H-7650, Hitachi, Japan).

TUNEL Assay

Hepatocellular apoptosis was detected with a TUNEL apoptosis assay kit (Roche, Switzerland). All procedures were performed as described in the assay kit. Ten microscopic fields within the view were randomly selected, and the TUNEL-positive cells were counted. Liver apoptosis rate was evaluated using the average number of positive cells division by the average number of total cells.

Real-time PCR analysis

The total RNA isolated from liver samples using TRIzol reagent was reverse transcribed to obtain cDNA. The primers were synthesized by Takara Biomedical Technology Co., Ltd. (Dalian, China). The primer sequences are listed in Table 1. Real-time qPCR was performed by using FastStart Universal SYBR Green Master (Rox) (Roche, USA). In this experiment, the response system of 20 μL was used and GAPDH was used as the internal reference for relative quantitative analysis of gene mRNA expression level. Relative quantification was performed according to 2^-^ΔΔ^Ct method.

Western Blot Analysis

The expression of p-PERK、p-IRE-1α、CHOP、Bcl-2 proteins were detected via Western blot. The liver tissues were homogenized on ice, diluted with 10 volumes of natural saline, and then centrifuged at 2500 rpm for 10 min. The supernatants were transferred into fresh tubes for biochemic alanalysis. Nuclear and cytoplasmic proteins were extracted by using nuclear and cytoplasmic extraction reagents according to the manufacture’s procedure (Solarbio, China), and then separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene fluoride (PVDF) membranes. Blocking by 10% skimmed milk for 2 h, and then the membranes were incubated at 4℃ overnight with rabbit anti-CHOP (1:1000; CST, USA), rabbit anti-Bcl-2 (1:1,000; CST, USA), rabbit anti-p-PERK (1:500; Bioss, China), and rabbit anti-p-IRE-1α (1:500; Bioss, China), and β-actin (1:500; Bioss, China). After cleaning with TBST buffffer, the membranes were incubated with secondary antibodies labeled by alkaline phosphatase (1:500; Bioss, China) for 2 h. Finally, BCIP/NBT substrate developer (Solarbio, China) was added to examine blots, and analyzed gray level by Image J software.

Statistical analysis

Data were analyzed by SPSS 22.0 (SPSS, IL, USA) statistical analysis software and expressed as mean ± standard deviation (X ± SD). Differences among groups were determined for statistical significance using oneway ANOVA and were considered statistically significant at P < 0.05. Graphpad Prism 5 (San Diego, California) was used to made graphs.

Effects of DEX on IR-induced liver histopathology

Liver histopathological changes were analyzed in all six groups. There were no pathological changes in the liver tissue sections from the sham group, and the hepatocytes showed an intact structure with no degeneration or necrosis, and no inflammatory cell infiltration (Figure 1 aA). However, IR-induced liver histopathological changes were observed in the liver tissue including disrupted hepatic cell cords, extensive hepatic necrosis, hemorrhage, vacuolar degeneration, and inflammatory cell infiltration (Figure 1 aB). Interestingly, DEX administration significantly reduced IR‐induced liver histopathological changes with neatly arranged hepatocytes, a small amount of inflammatory cell infiltration and bleeding (Figure a C-F). The pathological score of liver injury is shown in figure 1 b. The liver injury score of IR group was significantly higher than that of other groups (p < 0.01). Compared with group DL and DH, the liver injury score in group DM1 was significant lower (p < 0.01). There was no significant difference in liver injury score between DM1 group and DM2 group (p＞0.05).

Effects of DEX on IR-induced hepatocyte morphological changes

The hepatocyte ultrastructural changes were also analyzed in all groups by transmission electron microscopy. As shown in Figure 2 A, the morphology structure of hepatocytes from the sham group was normal with intact cell and nuclear membranes. In the IRI group the hepatocyte mitochondria were swollen and the ridges of mitochondria were uneven, the hepatocytes ER were damaged and expanded (Figure 2 B). DEX alleviated the damage in both organelles, whereas the nuclear membrane structure in the DL and DH group is slightly incomplete.

DEX decreases serum ALT activity and reduces liver oxidative stress induced by IR

We initially investigated specific indicators of liver function and oxidative stress damage, including ALT level, MDA concentration and SOD activity. As expected, serum ALT level and liver MDA concentration in the IR-induced rats were significantly higher compared with that of sham rats (Figure 3 a, b; p < 0.01), and IR significantly reduced lipid peroxidation. SOD activity in the liver (Figure 3 c) was significantly decreased in group IR (p < 0.01), DEX intervention markedly inhibited the increase in serum ALT activity, liver MDA level and the decrease in liver SOD activity induced by IR, indicating that DEX has a protective effect in IR-induced liver injury. Among the three pre-administration groups, the concentration of ALT and MDA in DM1 group was the lowest and the activity of SOD was the highest. There was no significant difference in ALT and MDA concentration and SOD activity between DM1 and DM2 group (p＞0.05).

DEX ameliorates IR-induced hepatocyte apoptosis

TUNEL staining was used to assess apoptosis in the liver. The sham group showed few apoptotic hepatic cells (Figure 4 aA).The number of TUNEL positive cells increased significantly in the IR group compared to that in group S (Figure 4 aB; p < 0.01). In addition, the number of TUNEL positive cells in the DM1, DH, DM2 groups decreased significantly compared to that in the IR group (Figure 4 aD-F; p < 0.01 or p < 0.05). Notability, hepatocyte apoptosis rate in the DM1 group was significantly lower than in the DL group (p < 0.01); hepatocyte apoptosis rate in the DH group was not significantly different from that in the DM1 group (p＞0.05). There was no significant difference in hepatocyte apoptosis rate between DM1 group and DM2 group (p＞0.05).

Effect of DEX on core protein of ERS

The GRP78 mRNA level is shown in figure 5. The expression of GRP78 mRNA in the IR group was increased significantly compared with that in group S (P < 0.01), whereas DEX weakened this increase significantly. There was no statistical difference between group S and group DM1 (p＞0.05). Compared with group DL and DH, mRNA level of GRP78 in group DM1 was slightly decreased. There was no significant difference in the expression of GRP-78 mRNA between DM1 group and DM2 group (p＞0.05).

Effect of HRS on expression of UPR signaling protein in liver

We measured the mRNA levels of PERK, ATF-6 and the protein expression levels of p-PERK, p-IRE-1 α, and found them to be significantly higher in the IR group than those in the sham group (P < 0.01; Figure 6), whereas DEX treatment reversed these effects significantly. In addition, all the indicators mentioned above in DM1 group were the lowest among the three pre-administration groups. Notably, mRNA levels of PERK, ATF-6 and protein expression levels of p-PERK, p-IRE-1 α in the DH group and DM2 group were not significantly different from that in the DM1 group (p＞0.05).

Effect of DEX on the expression of ERS apoptosis signaling protein in the liver

Compared with the sham group, the Caspase-12 mRNA level and the expression of the proteins of CHOP, Bcl-2 in the IR group were increased markedly. DEX not only reduced Caspase-12 mRNA level and the expression level of CHOP protein significantly (P < 0.01; Figure 7 a, b), but also increased the expression level of Bcl-2 protein (P < 0.01; Figure 7 c). Compared with group DL and DH, the Caspase-12 mRNA level and the expression level of CHOP protein in group DM1 was significant lower (p < 0.01). There was no significant difference in the above two indicators between DM1 group and DM2 group (p＞0.05). The expression level of Bcl-2 protein in the DM1 group was significantly higher than in the DL, DH, DM2 groups (p < 0.01).

Patients undergoing liver surgery remain at high risk of perioperative and postoperative complications despite recent surgical advances in the field. Many of these potential complications are a consequence of hepatic IRI with subsequent free radical formation, organelle failure, and release of pro-inflammatory mediators. Unraveling the underlying processes of hepatic IRI and developing measures to address this devastating condition are therefore of great interest.

In recent years, more and more studies have shown that DEX has a certain protective effect on liver during ischemia-reperfusion, and its mechanism may focus on oxidative stress and apoptosis ^[23]. The pathway of apoptosis mediated by endoplasmic reticulum stress has gradually attracted the attention of scholars. It may be a very effective method to reduce hepatic ischemia-reperfusion injury by regulating endoplasmic reticulum stress. Therefore, in this experiment, the rat model of hepatic ischemia-reperfusion injury was established, and different doses of DEX were given at different times to explore the mechanisms underlying these hepatoprotective effects in hepatic IRI with a focus on ERS apoptosis pathways. We found that hepatic IRI could upregulate the expression of ERS marker GRP78, activate the three UPR signaling proteins PERK, ATF6 and IRE1, and induce expression of ERS-related apoptosis proteins CHOP, Caspase-12 and Bcl-2. DEX intervention can ameliorate IR-induced hepatic injuries by suppressing hepatocyte ERS and apoptosis.

In the current study, histological analysis indicated that IR causes changes in the liver cells, such as liver cell necrosis, blood cell destruction and inflammatory cell infiltration, DEX could ameliorate pathological liver damage. Hepatocyte morphological analysis indicated that IR induced mitochondria swelling, endoplasmic reticulum swelling and structure disorder, DEX could protect against liver cell organelles damage. ALT mainly exists in hepatocytes. When hepatocytes are necrotic, ALT is released into the blood, which is one of the important signs of acute hepatocyte injury ^[24]. As shown in Fig. 3a, DEX significantly improved liver function in rats undergoing hepatic IR. These results indicate that DEX can significantly reduce hepatic IRI damage.

Oxidative stress balance plays a key role in the process of ischemia and is one of the important ways to lead to hepatocyte injury. MDA is the final product of lipid peroxidation in the process of oxidative stress, which can directly damage the cell membrane structures such as hepatocyte membrane and mitochondrial membrane. The content of MDA is an important index to reflect the degree of hepatocyte injury ^[25]. As an antioxidant enzyme, SOD plays an important role in the antioxidant process of cells, so the activity of SOD is also an important index to measure the degree of oxidative stress injury in hepatocytes ^[26]. In this study, the increase of MDA level and the decrease of SOD activity induced by IR were reversed by DEX treatment. According to these results, the protective mechanism of IR seems to be related to the antioxidant properties of DEX. There is evidence showing that oxidative stress, ER stress and inflammation are inseparably linked, in particular, the degree of oxidative stress greatly influences UPR signaling pathways. In the present study, we did not demonstrate a causal relationship between oxidative stress and ER stress; this is an area to explore in more details in our future work.

The ER is a dynamic and stable organelle involved in protein translation, lipid biosynthesis and calcium homeostasis ^[27]. Cells exposure to hypoxia can cause accumulation of unfolded proteins in endoplasmic reticulum lumen, leading to ERS ^[28]. IRI leads to hypoxia, oxidative stress and calcium overload, all of which can induce ER failure that in turn triggers ERS and cell apoptotic. Li et al. showed that DEX attenuated myocardial ischemia reperfusion injury in diabetes mellitus rats and H/R injury cell, which is associated with the reduction of ERS-induced cardiomyocyte apoptosis ^[29]. Consistent with this, DEX significantly alleviated the hepatocyte ERS induced by IR.

GRP78 is mainly located in endoplasmic reticulum and plays a key role in promoting protein folding and assembly, protein transport and calcium homeostasis, and is related to the regulation of ER transmembrane transduction ^{[30, 31]}. When ERS occurs, GRP78 dissociates from its complex with three sensory proteins, which is then up-regulated and associated with misfolded and unfolded proteins. Free sensory proteins activate three signal transduction pathways of ERS ^[32]. Therefore, the expression level of GRP78 can be used as one of the markers of ERS. In this study, we found that the level of GRP78 mRNA in liver IR increased, indicating the activation of ERS. In addition, compared with the IR group, the expression of GRP78 mRNA in the liver of other groups decreased significantly. These results suggest that DEX can down-regulate the increase of ERS induced by IR in liver.

ERS is also known as unfolded protein response (UPR). In the process of UPR, GRP78 is separated from ERS receptor proteins PERK, IRE1- α and ATF-6, and binds to unfolded proteins. The isolated three transmembrane proteins begin to induce stress signals and exert their effects, clearing misfolded proteins and leading to apoptosis ^[33]. In order to further explore the effect of IR on ER signaling pathway and the protective effect of DEX on ERS, we detected the expression level of PERK mRNA, ATF-6 mRNA, p-PERK protein and p-IRE-1 α protein in each group. In our study, IR significantly up-regulated the level of PERK mRNA, ATF-6 mRNA, up-regulated the expression of p-PERK protein and p-IRE-1 α protein, while DEX significantly down-regulated its expression, down-regulated the expression of p-PERK protein and p-IRE-1 α protein. These results suggest that DEX can inhibit the expression of UPR signal proteins to inhibit ERS, and thus participate in the regulation of liver IR.

Excessive or prolonged ERS activates apoptotic pathways and induces cell death. An increasing number studies have shown that apoptosis induced by ERS plays an important role in liver IRI ^{[34, 35]}.Under the ERS, Bcl-2 family proteins mediate endoplasmic reticulum Ca²⁺ release and caspase12 activation, which eventually lead to apoptosis. There are three main apoptotic pathways in ERS, CHOP activation pathway, JNK activation pathway, and caspase 12 activation pathways ^[36]. Caspase-12 is a key protease of ERS-mediated apoptosis attached to the ER. When ER is overstressed, the complete Caspase-12 response is activated, and then a series of proteins of the Caspase family are activated exponentially, resulting in cascade reaction to induce apoptosis ^[37], so the protein plays an important role in initiating the ER apoptosis pathway. CHOP is a specific ERS transduction factor and an important signal molecule for promoting apoptosis. In ERS, its expression is greatly increased and is considered to be one of the markers of endoplasmic reticulum stress ^[38]. In this study, we detected the expression of caspase 12 mRNA in each group, and detected the expression of apoptosis-related proteins (CHOP and Bcl-2) after liver IRI by Western blot analysis. The results showed that the expression of caspase 12 mRNA, CHOP and Bcl-2 protein in liver tissue were significantly up-regulated in IRI, while DEX significantly inhibited its expression. The TUNEL assay results further confirmed that IR can cause a significant increase in liver TUNEL-positive cells, and DEX can reduce the number of TUNEL‐positive cells. Our results further proved that DEX could inhibit the apoptotic liver of ERS induced by IRI.

In order to determine the dose-effect relationship of DEX’s protection against liver IRI and whether the effect is relate with the administration time, 25 µg/kg, 50 µg/kg and 100 µg/kg DEX were administrated by intraperitoneal injection at 30 min before ischemia or 30 min after reperfusion. Our results indicated that 50 µg/kg DEX significantly decreases the expression of ERS proteins and inhibits cell apoptosis, and provides a superior protection compared with 25µg/kg DEX. Our results are consistent with the previous study described by Robert et al ^[39]. that discovered DEX inhibited isofluraneinduced cortical injury in a dose-dependent manner within 50µg/kg. Whereas the effect on liver IR-induced ERS and cell apoptosis did not increase in 100 µg/kg DEX group, the possible reason is that the organ protection effect of DEX is associated with decreased organ vasoconstriction, which does not occur with rapid loading of DEX or an infusion of markedly high doses ^[40]. The specific mechanism remains to be further studied. At the dose of 50µg/kg, DEX injection 30 min before ischemia and 30 min after reperfusion did not present different effect on liver ERS and cell apoptosis. Our results are consistent with the previous study described by Gu et al. that showed both DEX administered intraperitoneally prior to and following ischemia markedly reduced remote lung injury induced by renal ischemia-reperfusion in mice ^[41]. But Schaak et al. discovered that DEX prior to ischemia, but not following it, attenuates intestinal IRinduced intestinal injury ^[42]. This is an area should be evaluated further in our future work.

In conclusion, this study revealed that DEX can protect liver IRI by reducing ERS, thereby inhibiting ERS-related apoptosis. The protective effect of DEX on hepatic IRI was dose-dependent in a certain dose range, and both DEX administered prior to ischemia and following reperfusion markedly reduced liver injury induced by hepatic IRI in mice.

Dex: dexmedetomidine; IRI: ischemia-reperfusion injury; HE: haematoxylin–eosin; TUNEL: terminal deoxynucleotidyl transferase-mediated dUTP biotin nick end labelling; ERS: endoplasmic reticulum stress; PERK: protein kinase R-like ER kinase; ATF6: activating transcription factor 6; IRE1: Inositol-requiring enzyme 1; CHOP: C/EBP homologous protein; ALT: alanine aminotransferase; MDA: malondialdehyde; SOD: superoxide dismutase; TEM: transmission electron microscope;

Authors’ contributions

SZ and JT designed the research; WZ carried out the experiments, analysed the data; JT, HL and LA cooperated on carrying out the research; HL wrote the manuscript; JT co-wrote the manuscript; All authors read and approved the final manuscript.

Author details

¹College of Veterinary Medicine, Hebei Agricultural University, Baoding, People’s Republic of China.

²College of Veterinary Medicine, Northeast Agricultural University, Harbin, People’s Republic of China.

Acknowledgements

Not applicable

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Consent for publication

Not applicable.

Ethics approval and consent to participate

The study was allowed by the Agricultural University of Hebei Ethical Committee, Baoding, PR China.

Funding

This work was supported by the National Natural Science Foundation of China (grant number 31802250), the Scientific and Technological Research of Institution of Higher Learning Foundation of Hebei Province of China (BJ2019053).

Liao XZ, Zhou SQ, Zong J, Wang ZP. Sevoflurane exerts protective effects on liver ischemia/reperfusion injury by regulating NFKB3 expression via miR-9-5p. Exp Ther Med. 2019;17(4):2632–40.
Deng JF, Feng J, Liu T, Lu XY, Wang WW, Liu N, et al. Beraprost sodium preconditioning prevents inflammation, apoptosis, and autophagy during hepatic ischemia-reperfusion injury in mice via the P38 and JNK pathways. Drug Des Devel Ther. 2018;12:4067–82.
Xie TJ, Li K, Gong X, Jiang R, Huang WY, Chen XH, et al. Paeoniflorin protects against liver ischemia/reperfusion injury in mice via inhibiting HMGB1-TLR4 signaling pathway. Phytother Res. 2018;32(11):2247–55.
Ji J, Wu LW, Feng J, Mo WH, Wu JY, Yu Q, et al. Cafestol preconditioning attenuates apoptosis and autophagy during hepatic ischemia-reperfusion injury by inhibiting ERK/PPARγ pathway. Int Immunopharmacol. 2020;84:106529.
Hou Y, Fu JR, Sun ST, Jin YC, Wang XF, Zhang LS, et al. BDE-209 induces autophagy and apoptosis via IRE1α/Akt/mTOR signaling pathway in human umbilical vein endothelial cells. Environ Pollut. 2019;253:429–38.
Zhan F, Zhao GP, Li X, Yang SK, Yang WJ, Zhou S, et al. Inositol-requiring enzyme 1 alpha endoribonuclease specific inhibitor STF-083010 protects the liver from thioacetamide-induced oxidative stress, inflammation and injury by triggering hepatocyte autophagy. Int Immunopharmacol. 2019;73:261–9.
Malhi H, Kaufman RJ. Endoplasmic reticulum stress in liver disease. J Hepatol. 2011;54(4):795–809.
Li JJ, Zhao Y, Zhou N, Li LY, Li K. Dexmedetomidine attenuates myocardial ischemia-reperfusion injury in diabetes mellitus by inhibiting endoplasmic reticulum stress. J Diabetes Res. 2019; 2019: 7869318.
Kim I, Xu WJ, Reed JC. Cell death and endoplasmic reticulum stress: disease relevance and therapeutic opportunities. Nat Rev Drug Discov. 2008;7(12):1013–30.
Li H, Bai G, Ge YS, Zhang QZ, Kong XD, Meng WJ, et al. Hydrogen-rich saline protects against small-scale liver ischemia-reperfusion injury by inhibiting endoplasmic reticulum stress. Life Sci. 2018;194:7–14.
Jiao ZH, Liu XN, Ma YJ, Ge YS, Zhang QZ, Liu BY, et al. Adipose-derived stem cells protect ischemia-reperfusion and partial hepatectomy by attenuating endoplasmic reticulum stress. Front Cell Dev Bio. 2020;8:177.
Chi XB, Jiang Y, Chen YB, Yang F, Cai QC, Pan F, et al. Suppression of microRNA27a protects against liver ischemia/reperfusion injury by targeting PPARγ and inhibiting endoplasmic reticulum stress. Mol Med Rep. 2019;20(5):4003–12.
Selzner N, Rudiger H, Graf R, Clavien PA. Protective strategies against ischemic injury of the liver. Gastroenterology. 2003;125(3):917–36.
Weerink MAS, Struys M, Hannivoort LN, Barends CRM, Absalom AR, Colin P. Clinical pharmacokinetics and pharmacodynamics of dexmedetomidine. Clin Pharmacokinet. 2017;56(8):893–913.
Liu ZG, Wang YP, Wang YQ, Ning QQ, Zhang Y, Gong CZ, et al. Dexmedetomidine attenuates inflammatory reaction in the lung tissues of septic mice by activating cholinergic anti-inflammatory pathway. Int Immunopharmacol. 2016;35:210–6.
Chen Z, Ding T, Ma CG. Dexmedetomidine (DEX) protects against hepatic ischemia/reperfusion (I/R) injury by suppressing inflammation and oxidative stress in NLRC5 deficient mice. Biochem Biophys Res Commun. 2017;493(2):1143–50.
Sun ZX, Zhao TY, Lv SJ, Gao Y, Masters J, Weng H. Dexmedetomidine attenuates spinal cord ischemia–reperfusion injury through both anti-inflammation and anti-apoptosis mechanisms in rabbits. J Transl Med. 2018;16(1):209.
Kiliç K, Hanci V, Selek S, Sözmen M, Kiliç N, Citil M, et al. The effects of dexmedetomidine on mesenteric arterial occlusion-associated gut ischemia and reperfusion-induced gut and kidney injury in rabbits. J Surg Res. 2012;178(1):223–32.
Zhou HM, Sun J, Zhong WZ, Pan XX, Liu CM, Cheng F,et al. Dexmedetomidine preconditioning alleviated murine liver ischemia and reperfusion injury by promoting macrophage M2 activation via PPARγ/STAT3 signaling. Int Immunopharmacol. 2020;82:106363.
Wang YH, Wu S, Yu XF, Zhou SL, Ge M, Chi XJ, et al. Dexmedetomidine protects rat liver against ischemia-reperfusion injury partly by the α2A-adrenoceptor subtype and the mechanism is associated with the TLR4/NF-κB pathway. Int J Mol Sci. 2016;17(7):995.
Gao WD, Feng ZJ, Zhang SL, Wu B, Geng X, Fan GX, et al. Anti-inflammatory and antioxidant effect of eucommia ulmoides polysaccharide in hepatic ischemia-reperfusioninjury by regulating ROS and the TLR-4-NF- κ B pathway. BioMed Res Int. 2020; 2020: 1860637.
Suzuki S, Nakamura S, Koizumi T, Sakaguchi S, Baba S, Muro H, et al. The beneficial effect of a prostaglandin I2 analog on ischemic rat liver. Transplantation. 1991;52(6):979–83.
Zhai M, Liu C, Li YX, Zhang PJ, Yu ZQ, Zhu H, et al. Dexmedetomidine inhibits neuronal apoptosis by inducing Sigma-1 receptor signaling in cerebral ischemia-reperfusion injury. Aging. 2019;11(21):9556–68.
Chen G, Deng HZ, Song X, Lu M, Zhao L, Xia S, et al. Reactive oxygen species-responsive polymeric nanoparticles for alleviating sepsis-induced acute liver injury in mice. Biomaterials. 2017;144:30–41.
Zhang JP, Cao H, Zhang Y, Zhang YY, Ma JJ, Wang JY, et al. Nephroprotective effect of calcium channel blockers against toxicity of lead exposure in mice. Toxicol Lett. 2013;218(3):273–80.
Zhang WQ, Xue JD, Ge M, Yu ML, Liu L, Zhang ZG. Resveratrol attenuates hepatotoxicity of rats exposed to arsenic trioxide. Food Chem Toxicol. 2013;51:87–92.
Avril T, Vauléon E, Chevet E. Endoplasmic reticulum stress signaling and chemotherapy resistance in solid cancers. Oncogenesis. 2017;6(8):e373.
Lee WJ, Chien MH, Chow JM, Chang JL, Wen YC, Lin YW, et al. Nonautophagic cytoplasmic vacuolation death induction in human PC-3M prostate cancer by curcumin through reactive oxygen species-mediated endoplasmic reticulum stress. Sci Rep. 2015;5:10420.
Li JJ, Zhao Y, Zhou N, Li LY, Li K. Dexmedetomidine attenuates myocardial ischemia-reperfusion injury in diabetes mellitus by inhibiting endoplasmic reticulum stress. J Diabetes Res. 2019; 2019: 7869318.
Dudek J, Benedix J, Cappel S, Greiner M, Jalal C, Müller L, et al. Functions and pathologies of BiP and its interaction partners[J]. Cell Mol Life Sci. 2009;66(9):1556–69.
Lee AS. Mammalian stress response: induction of the glucose-regulated protein family. Curr Opin Cell Biol. 1992;4(2):267–73.
Hetz C. The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Bio. 2012;13(2):89–102.
Shen JS, Chen X, Hendershot L, Prywes R. ER Stress Regulation of ATF6 Localization by Dissociation of BiP/GRP78 Binding and Unmasking of Golgi Localization Signals. Dev Cell. 2002;3(1):99–111.
Fan CX, Yang Y, Liu Y, Jiang S, Di SY, Hu W, et al. Icariin displays anticancer activity against human esophageal cancer cells via regulating endoplasmic reticulum stress-mediated apoptotic signaling. Sci Rep. 2016;6(1):69–90.
Rao JH, Qin JJ, Qian XF, Lu L, Wang P, Wu ZS, et al. Lipopolysaccharide pre-conditioning protects hepatocytes from ischemia/reperfusion injury (IRI) through inhibiting ATF4-CHOP pathway in mice. PLoS One. 2013;8(6):e65568.
Ding WX, Zhang XF, Huang HP, Ding N, Zhang SJ, Hutchinson SZ, et al. Adiponectin protects rat myocardium against chronic intermittent hypoxia-induced injury via inhibition of endoplasmic reticulum stress. PLoS One. 2017;9(4):e94545.
Chen YH, Wu XD, Yao ST, Sun S, Liu XH. Calcineurin is involved in cardioprotection induced by ischemic postconditioning through attenuating endoplasmic reticulum stress. Chin Med J. 2011;124(20):3334–40.
Yan L, Wang SL, Ren BS, Wang J, Chen J, Lu J, et al. CHOP favors endoplasmic reticulum stress-induced apoptosis in hepatocellular carcinoma cells via inhibition of autophagy. PloS one. 2017;12(8):e0183680.
Sanders RD, Xu J, Shu Y, Januszewski A, Halder S, Fidalgo A, et al. Dexmedetomidine attenuates isoflurane-induced neurocognitive impairment in neonatal rats. Anesthesiology. 2009;110(5):1077–85.
Cai Y, Xu H, Yan J, Zhang L, Lu Y. Molecular targets and mechanism of action of dexmedetomidine in treatment of ischemia/reperfusion injury. Mol Med Rep. 2014;9(5):1542–50.
Gu J, Chen J, Xia P, Tao G, Zhao H, Ma D. Dexmedetomidine attenuates remote lung injury induced by renal ischemia-reperfusion in mice. Acta Anaesthesiol Scand. 2011;55(10):1272–8.
Schaak S, Cussac D, Cayla C, Devedjian JC, Guyot R, Paris H, et al. Alpha(2) adrenoceptors regulate proliferation of human intestinal epithelial cells. Gut. 2000;47(2):242–250.

Table 1 Primer Sequence of the genes were tested in the present study.

Gene	Number	Primer sequences (5′-3′)
GaPdh	Nm-017008.4	Forward: GGCACAGTCAAGGCTGAGAATG
		Reverse: ATGGTGGTGAAGACGCCAGTA
PERK	Nm-031599.2	Forward: CCAAGCTGTACATGAGCCCAGA
		Reverse: TTTCTGAGTGAACAGTGGTGGAAAC
ATF-6	Nm-001107196.1	Forward: ATCACCTGCTATTACCAGCTACCAC
		Reverse: TGACCTGACAGTCAATCTGCATC
GRP-78	Nm-013083.2	Forward: TCAGCCCACCGTAACAATCAAG
		Reverse: TCCAGTCAGATCAAATGTACCCAGA
Caspase-12	Nm-130422.1	Forward: AAATGGAGGTAAATGTTGGAGTGG
		Reverse: CTGCCCTTTCTGTCTTCATCGT

Download PDF

Version 1

posted

You are reading this latest preprint version

Dexmedetomidine Protects against Hepatic Ischemia-Reperfusion Injury by inhibiting Endoplasmic Reticulum Stress and Cell Apoptosis in Rats

Status:

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Status:

Version 1