Cell lines and human tissue samples
We have collected tumor and paraneoplastic specimens of 47 patients who underwent radical surgery between 2015 and 2019. All patients did not undergo radiotherapy and chemotherapy. Fresh biopsy tissue is frozen and stored in liquid nitrogen until being used. All plasma samples were collected from NSCLC patients (40 without metastasis and 40 with metastasis )in our hospital between April 2013 and June 2019, and age-matched healthy human plasma samples (n = 30) were selected from the Physical Examination Center of our hospital. The blood sample was then centrifuged at 2500g for 10 minutes to extract the serum and stored at -80 ° C. Each patient has signed an informed consent form and this was approved by the Ethics Committee of the First Affiliated Hospital of Nanjing Medical University.
This study involved 4 human NSCLC cell lines (H1299, SPCA1, PC9, A549), 1 human bronchial epithelioid cell line (16HBE) and HUVEC (human umbilical vein endothelial cells). All cell lines were purchased from Shanghai Academy of Sciences. (H1299, SPCA1, PC9, A549 were cultured in DMEM medium (GIBCO, Gaithersburg, USA) supplemented with 10% fetal bovine serum. HUVEC was cultured in F12-K medium (GIBCO with 10% fetal bovine serum , Gaithersburg, USA). 16HBE was cultured in Defined Keratinocyte SFM medium (GIBCO, Gaithersburg, USA) containing 10% fetal bovine serum (HyClone, Logan, USA).
Microarray analysis
The miRNA 4.0 Array of Affymetrix was used to analyze the miRNA expression in serum exosomes (normal) of healthy people and in NSCLC patients with lymph node metastasis. What we have done has obtained the approval from the First Affiliated Hospital of Nanjing Medical University (Nanjing, China). Informed consent was signed by each patient on the day of admission. Three clinical samples were collected from each group. The miRNA array experiment was conducted in the microarray core laboratory of Beijing Boao Jingdian Biotechnology Co., Ltd. (Beijing, China).
Cell transfection
Lentiviral vectors that over-express miR-3157-3p and repress miR-3157-3p were constructed and generated. Mimics and inhibitor were purchased from GiKai GENE (Shanghai, China) and transfected according to the manufacturer's instructions. Plasmid TIMP2 / KLF2, empty vector, si-TIMP2 / si-KLF2 were purchased from Gene Pharma (Shanghai, China). Transfection was performed using elipofectamine 3000 reagent (Invitrogen) according to the manufacturer's instructions.
PCR
To determine the expression level of miR-3157-3p, total RNA was isolated and extracted from tissues and cells by TRIzol reagent (Invitrogen, CA, USA) according to the instructions. CDNA was generated by reverse transcription using total RNA and PrimeScriptRT reagent (Takara, Kusatsu, Japan), and detected using SYBR Green (Takara) at ABI StepOnePlus real time quantitative PCR instrument (StepOnePlus, ABI Company, Oyster Bay, NY, USA). Taking GAPDH and U6 as endogenous controls, mRNA and miRNA were normalized. The 2−ΔΔCT method was used to quantify the relative levels of mir-3157-3p and TIMP2/KLF2. Each sample is in triplicate. miRNA quantification: Bulge-loopTM miRNA qRT-PCR Primer Sets (one RT primer and a pair of qPCR primers for each set) specific for miR-3157-3p is designed by RiboBio (Guangzhou, China). The oligonucleotides used in this study: U6 F:CTCGCTTCGGCAGCACATATACT.U6 R:ACGCTTCACGAATTTGCGTGTC. GAPDH F: AAGGTGAAGGTCGGAGTCA.GAPDH R:GGAAGATGGTGATGGGATTT
Isolation and identification of exosomes
Exosomes were purified from NSCLC cell supernatant or NSCLC patient serum by ultracentrifugation. NSCLC cells were cultured in DMEM medium supplemented with 10% fetal bovine serum without exosomes. Total Exosome Isolation Reagent (from cell culure media, Invitrogen, USA) is used to extract exosomes from cell supernatant, and the amount of exosomes was measured by BCA protein assay kit (KeyGEN BioTECH). For transmission electron microscopy(TEM), 5-10u extracted exosomes are placed on the copper carrier grid. Add 10-20μl of EM solvent dropwise, and carefully suck up with clean filter paper after 1min, then observe the exosomes with Philips CM120 biological dual transmission electron microscope (FEI Company, USA). The method of Nanoparticle-tracking analysis is used to analyze the size of exosomes. The exosomes (10-20 mg) in 1 mL PBS and vortex were dissolved for 1min to distribute the exosomes evenly. Then, the NanoSight Nanoparticle Tracking Analyzer (NTA, Malvern Analysis, UK) was used to measure and observe the scale distribution of the exosomes. For exosome labeling, PKH67 membrane dye (Sigma) was used to fluorescently label exosomes according to the instructions.
Dual luciferase report
The 3'UTR fragments of KLF2 and KLF4 genes were amplified and inserted into the vector. Then complete co-transfection of TIMP2 and KLF2 3'UTR plasmids with miR-3157-3p lentiviral vector into cells by using Lipofectamine 2000 (Invitrogen USA). 48 hours after the transfection, Dual-Lumi ™ dual luciferase reporter gene detection kit (Biyuntian: RG088S) detects dual luciferase. The Renilla activity was taken as a normalization of luciferase activity. All measurements were performed in triplicate, and each experiment was repeated three times.
Western blotting
The total protein was extracted from the cells with the RIPA reagent (Beyotime, Shanghai, China) who contains 10 μg / mL Phosphatase inhibitor and 100 μg / mL PMSF (Beyotime, Shanghai, China). The protein were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene difluoride (PVDF) membrane. After sealing for 1 hour, the membrane were diluted with primary antibody diluted, TIMP2 (SAB, # 41500, 1: 500 dilution) vascular endothelial growth factor (VEGF ) (SAB, # 320217, 1: 500 dilution) (MMP2) (Abcam, ab92536, 1: 1000 dilution), MMP-9 (Abcam, ab76003, 1: 1000 dilution), ZO-1(Abcam, ab96587, 1: 500 dilution), occludin(Abcam, ab216327, 1: 1000 dilution), claudin 5(GeneTex, GTX00796, 1: 500 dilution) and GAPDH (Abcam, ab181602, 1: 10000 dilution) overnight at 4 ° C. The TBST was washed 5 minutes for three times and then incubated for 2h in the corresponding secondary antibody. After which, it was developed by enhanced chemiluminescence (ECL).
EDU assay, migration assay, and angiogenesis assay.
From EDU we know that spread the transfected cells evenly in a 24-well plate with 3 × 104 cells per well, then use EdU Apollo567 extracorporeal flow cytometry kit (Guangzhou RiboBio) to perform EdU according to the instructions, by which we can acquire images with a fluorescence microscope. From recruitment assay, we get the following result:Approximately 2×104 cells in serum-free medium(400 μl) were seeded into the upper Transwell chamber for migration assay, who use 8.0μm Transwell Permeable Supports (Corning, New York, USA). The lower chamber was supplemented with 600μl DMEM medium containing 10% FBS, and was incubated at 37 °C for 24 hours. Remaining cells in the upper membrane were cleared with Cotton swabs, and they were stained with paraformaldehyde and 0.1% crystal violet (Beyotime, Shanghai, China) for 20 minutes at 37°C.
Tube formation: Spread 250u Matrigel (BD Bioscience, USA) on a 24-well plate and place in an incubator for half an hour. Approximately 1 × 105 treated HUVEC cells were resuspended in each well of a 24-well plate.Tube formation was induced at 37 ° C for 8 h. Then we observe the tube length with a microscope. For the measurement of the aortic ring, the thoracic aorta cut from Sprague Dawley (SD) rats of 10 to 12 weeks old was cut into a cross section of 1 to 2 mm in length. Place the ring on the wells coated with Matrigel, using F12-K medium (GIBCO, Gaithersburg, Maryland, USA), containing 10% fetal bovine serum, supplemented with 10ng / ml vascular endothelial growth factor and 25μg / ml Heparin per well. After 24 hours, the aortic ring was incubated with conditioned medium derived from NSCLC cells or exosomes transfected with miR-3157 mimics, miR-3157 inhibitors. After 5 days, observe the number of buds with a microscope, and quantify blood vessel growth by counting all buds from one ring [30]. From CAM, we get the result: Incubate 20 fertilized eggs at 37.5 ° C and 70% humidity for 8 days, and an artificial airbag was created, also a small window was cut in the shell above the artificial airbag. We use exo-miR-3157-3p-mimics, exo-NC mixed with equal volume of Matrigel (BD Biosciences, Bedford, MA) to inject into CAM. The area around the implanted Matrigel was photographed, and the number of blood vessels was obtained by counting the branches of the blood vessels[31]. Each experiment was repeated three times. From the in vitro permeability measurement, we get the following result: Rhodamine B isothiocyanate-dextran (Sigma) was added to the top well of the transwell filter, and HUVEC (105 cells per well) was treated on it for 3 days. Then collect the culture medium in the bottom well after 30 minutes and monitor the appearance of fluorescence under 544 nm excitation and 590 nm emission.
Animal experiment
The six-week-old nude mouse was purchased from the Animal Center of Nanjing Medical University (Nanjing, China) and what we have done was approved by the Animal Ethics Committee of Nanjing Medical University. Nude mice were randomly divided into 4 groups, 4 in each group. The 3 × 106 A549 cell samples were injected subcutaneously into the groin area of BALB / c nude mice. After 9 days, 5 µg of exosomes were injected into xenografts every other day. Three days after the last injection, the tumor tissue was dissected, fixed in 10% formalin, and embedded in paraffin for further study. For the determination of tail vein metastasis, 6-week-old nude mice were injected with 5 µg exosomes through the tail vein every other day for 2 weeks. The 2 × 106 A549 cells were injected into the tail vein of nude mice treated with exosomes. After 60 days, the mice were sacrificed, and the lungs were removed for examination and HE staining.
Statistical analysis
All statistical analyses were performed by spss 19.0 and GraphPad software 8.0. The P-values were analysed with Student’s t test, one-way ANOVA. We select for statistical significance when P is less than 0.05.