Materials
GAS was purchased from Nanjing Baide Biotechnology Co., Ltd. (> 99% purity, Nanjing, China). Complete Freund’s adjuvant (CFA) and Von Frey filaments were purchased from Sigma (St. Louis, MO). Elevated Plus Maze Video Tracking System was purchased from Shanghai Xinruan Information Technology Co., Ltd. (Shanghai, China). YLS-6A Intelligent hot plate was purchased from Jinan Yiyan Technology Development Co., Ltd. (Shandong, China). ABI7500 Real-Time PCR Detection Systems was purchased from Bio-Rad (Hercules, California). AxyPrep™ Multisource Total RNA was purchased from AXYGEN (Silicon Valley, California). SYBR Green qPCR Mix(2X) was purchased from Beyotime Biotechonology (Shanghai, China). D7260 Prime Script TMRT Reagent Kit was purchased from TaKaRa (Liaoning, China); RR037A primer was purchased from Sangon Biotech (Shanghai, China).
Animals and grouping
Male C57BL/6J mice (aged 8 weeks, weighing 21-25g) were purchased from Chengdu Dashuo Laboratory Animal. Animals were housed in groups of six mice with a temperature (20 ± 2℃), humidity (55 ± 15%) and lighting (12 h light/dark cycle, lights on at 7:00 AM). All animals must adapt to conditions for at least 7 days after they arrived. Food and water were freely available.
The rats were randomly divided into four groups of six individuals each as follows: Blank group (0.9% physiological saline (SAL)-treated group, n = 6), Model group (The CFA-induced plus SAL-treated group, n = 6), the CFA-induced plus 100mg/kg GAS-treated group (CFA + 100 group, n = 6), the CFA-induced plus 200mg/kg GAS-treated group (CFA + 200 group, n = 6).
Experimental designs and GAS treatment
10ul CFA (50%) was injected intraplantar subcutaneously into the left hindpaws of mice to established chronic peripheral inflammatory pain. In the control group, the same volume of SAL was injected into the hindpaws of mice. GAS was dissolved in saline before use. The mice were intraperitoneally injected with GAS (100, 200 mg/kg) after CFA insult GAS or saline was used repeatedly in mice once a day for 2 weeks.
Mechanical allodynia
Mechanical allodynia was assessed with a set of von Frey filaments on day 1,4,7, and 14. Mice were placed on a wire mesh covered with organic glass and acclimated to the environment at least 30 minutes prior to test. Start with 0.4 mN(#2.44) filament and stimulate the center of left hindpaw until filament bending for 3s, and the mice have reactions like licking foot or foot lifting.
Thermal hyperalgesia
After 14 days of administration, the temperature of the hot plate was set to 55℃. The left hindpaw of mice was placed on the hot plate, and time was recorded when the mice had reactions like foot lifting.
Elevated plus-maze test
Mice were placed in the central zone of the maze facing the closed arm, and the time was recorded for 5min. Outcome measures: the number of entries in open arms, retention times of open arms, the number of entries in closed arms, retention times of closed arms. The number of entries in open arms and retention times of open arms were negatively correlated with anxiety in mice.
Open field test
Mice were placed in the center of the box, and the time of mice entering the central area was videotaped. The observation time is 5min.
Real-time Quantitative PCR (qRT-PCR)
The total RNA was extracted from the ACC and the spinalcord of the rat lumbosacral enlargement(L4-5) using TRIZOL reagent. D7260 Prime Script ™RT Reagent Kit performed reverse transcription for the synthesis of cDNA. Reverse transcription was the performed via Real-Time PCR System in a 20uL reaction mixture and while following the manufacturer’s instructions. SYBR Green qPCR Mix(2X) was used for QRT-PCR. The primers utilized here are shown in (Table 1).
Table 1
Specific gene primes sequences
Gene name | Forward prime (5' to 3') | Reverse prime (5' to 3') |
HO-1 | AGACACCGCTCCTCCAGT | TCAGGTATCTCCCTCCATT |
FTH1 | GCAGGATATAAAGAAACCAGA | TCTCAATGAAGTCACATAAGT |
GPX4 | GTCTGGCAGGCACCATGT | GTGACGATGCACACGAAACC |
PTGS2 | TGGAGGCGAAGTGGGTTTTA | GAGTGGGAGGCACTTGCATT |
GAPDH | GCAGAATTCCTGGCCAAGGTCATCCATGAC | GCAGGTACCGGGGCCATCCACAGTCTTCTG |
Statistical Analysis
All results are presented as mean ± standard deviation (S.D.) and were analyzed using SPSS (Version 13.0, Chicago, USA). A p value < 0.05 was considered to be statistically significant.