Human clinical samples
60 HCC patients tumor tissues, adjacent normal tissues, serum samples and health control serum at Wuhan No.1 Hospital. Affiliated to Huazhong University of Science and Technology. This study was approved by the ethics committee of our hospital. All patients wrote the informed consents.
Cell culture and transfection
HCC cell lines (SMMC-7721, HepG2, HCCLM3 and Huh7) and normal hepatic cell line H7702 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cell were cultured in DMEM medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen), 100 IU/mL penicillin, and 100 mg/mL streptomycin in a humidified atmosphere containing 5% CO2 at 37℃.
For knocking down RNF185-AS1, small interfering RNAs (siRNAs) targeting RNF185-AS1 (5'-GCAGTATTCTCGGCTGTAT-3') and negative control siRNA (si‐NC) were synthesized by GenePharma (Shanghai, China). For overexpression of integrin β5 (ITGB5), full-length cDNA of ITGB5 was with pc DNA3.1 vector, and the empty vector was used as the control. miR‐221‐5p mimics, negative control (NC) mimics, miR‐221‐5p inhibitor and NC inhibitor were obtained from GenePharma.. Cell transfections were conducted by using Lipofectamine 2000 Reagent (Life Technologies Corporation, Carlsbad) in accordance with the manufacturers’ instruction.
Quantitative real‐time PCR
Total RNAs were extracted using TRIzol Reagent (Invitrogen, Thermo
Fisher Scientific, Inc., Waltham, MA) from tissues or cells. Complementary DNAs were generated by using RNAs as templates through the Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA). qPCR was analyzed using the SYBR Green PCR Master Mix Kit (Takara Biotechnology Co., Ltd., Dalian, China) on an ABI 7500 Real‐Time PCR System (Applied Biosystems). The relative expression was normalized to glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) or U6 and calculated according to the 2−ΔΔCt method. The primer sequences were listed as follows: RNF185-AS1 (forward: 5′‐AAGCCACATGTCTCACCAGG‐3′ and reverse: 5′‐GCCGCTCTGTTCTCTTTCCT‐3′). miR‐221‐5p (forward: 5′‐ACACTCCAGCTGGGACCTGGCATACAATGT‐3′ and reverse: 5′‐CTCAACTGGTGTCGTGGA‐3′); GAPDH (forward: 5′‐GCTCCCTCTTTCTTTGCAGC‐3′ and reverse: 5′‐GGAAAGCCAGTCCCCAGAAC‐3′); U6 forward:
5′‐ CTCGCTTCGGCAGCACA‐3′ and reverse: 5′‐AACGCTTCACGAATTTGCGT‐3′).
Subcellular fractionation assay
The cytoplasmic and nuclear extracts were extracted from HCC cells with NE‐PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, Waltham, MA). The distribution of RNF185-AS1 in cytoplasm or nucleus was analyzed by qRT‐PCR analysis. The expression of U6 in nucleus, GAPDH in cytoplasm was used as control.
Cell counting kit-8(CCK-8)
The cell proliferation was determined using CCK-8 kit (DoJinDo, Shiga, Japan). HepG2 and Huh-7 cells (2.5×103 cells per well) were plated into 96 well plates after 48 h transfection. After incubation for 0, 24, 48 and 72 hours, 10ul of CCK-8 solution was added and determined at a wavelength of 450 nm.
Colony formation assay
HepG2 and Huh-7 cells (1×103 cells per well) were plated into 6 well plates after 48 h transfection and cultured with fresh growth medium every 3 days. Cell were cultured for 21 days and were stained with 0.5% crystal violet.
Cell migration and invasion assays
For analysis of cell migration and invasion, 2.0×104 cells were seeded in a transwell chamber (8-μm pore size; EMD Millipore, Billerica, MA, USA) with 200 μL serum-free DMEM. A volume of 500 μL of the medium containing 10% FBS was added to the lower chamber. The 24-well chambers were then incubated at 37°C for 24h, the cells on the lower surface of the membrane were fixed in 4% paraformaldehyde for 30 minutes and stained with 0.5% crystal violet. The transmembrane cells were counted under six random microscope fields.
Western blot analysis
Total proteins were prepared using RIPA lysis buffer (Beyotime, China). Proteins were quantified by BCA assay. Equal amounts of protein were separated by 10% SDS-PAGE and electrotransferred onto polyvinylidene difluoride membranes (Bio-Rad, USA). After being blocked using 5% non-fat milk for 1 h at room temperature, the primary rabbit anti‐human antibodies against E‐cadherin (ab1416, Abcam, Cambridge, MA), Vimentin (ab92547, Abcam), integrin β5 (ab184312, Abcam) and GAPDH (ab9485, Abcam) were supplemented overnight at 4℃. Then the members were washed with tris‐buffered saline Tween 20 for three times and probed with horse radish peroxidase-conjugated secondary antibodies (ab205718, Abcam) for 1 h at 37°C. The bands were visualized using a ChemicDocXRS system (Bio-Rad, USA).
Luciferase reporter assay
For luciferase reporter assay, the predicted sequences of RNF185-AS1 or integrin β5 were inserted into pGL3 vector (Promega, Madison, WI, USA). Afterward, these vectors were co-transfected with miR-221-5p mimics and its corresponding control into Huh7 and HepG2 cells. 48 hours later, luciferase reporter assay system (Promega) was performed to measure the luciferase activities.
RNA-binding protein immunoprecipitation (RIP) assay
RIP was carried out by using the EZMagna RIP kit (Millipore, Bedford, MA, USA) according to the manufacturer's instructions. In brief, cells were lysed and the lysates were incubated with magnetic beads conjugated with human anti-Ago2 antibody (ab57113, Abcam) or control anti-IgG (ab131368, Abcam). Immunoprecipitated RNAs were isolated by proteinase K and the expression of precipitated miRNAs was analyzed by qRT‐PCR.
Xenograft mouse model
Nude mice (female BALB/c-nu, 6 weeks old) were obtained from the National Laboratory Animal Center (Beijing, China). All experimental and animal care procedures were approved by the Animal Research Ethics Committee of Wuhan No.1 Hospital. The subcutaneous xenograft model was established by directly subcutaneously injecting 2×106 Huh7 cells stably transfected with si‐NC or si‐RNF185-AS1. Ki-67, ITGB5, E-cadherin and Vimentin immunohistochemistry analysis were conducted.
For the tumor metastasis model, 1×106 Huh7 cells transfected with si‐NC or si‐RNF185-AS1 were injected into mouse tail veins (n = 6 for each group). The mice were killed at the indicated time. Lungs were surgically retrieved from mice. Micrometastatic tumors in the lungs were counted. Tissues were embedded in paraffin, sectioned, stained with H&E.
Immunohistochemistry (IHC)
Tissue sections were prepared and subjected to immunohistochemical analysis. Anti-human Ki67 (ab15580,Abcam), ITGB5 (ab15459, Abcam), E-cadherin and Vimentin antibody was used as primary antibodies. HRP-conjugated secondary Ab was used as secondary antibody. Images were obtained using an Olympus-BX51 microscope.
Statistical analysis
All data of multiple experiments are presented as the mean ± standard deviation. SPSS 21.0 software (SPSS, Chicago, IL) was adopted for statistical analysis. The Kaplan-Meier analysis and log-rank test were used to calculate the overall survival. The one‐way ANOVA or student’s t test was adopted for the differences among groups. The value of p <0 .05 was considered to be significant.