Effects of slurry reflux on the stability and microbial community structure of corn stalk anaerobic digestion system

doi:10.21203/rs.3.rs-623948/v1

Download PDF

Original article

Effects of slurry reflux on the stability and microbial community structure of corn stalk anaerobic digestion system

https://doi.org/10.21203/rs.3.rs-623948/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Anaerobic digestion(AD) of corn stalks with slurry reflux and non-reflux was compared and evaluated,to clarify the effects of slurry reflux on AD. The reflux of slurry increased methane production by 45.8% and also improved the buffer capacity and adaptability to high organic load rate(OLR). The results of high-throughput sequencing showed that slurry reflux increased the richness of bacterial and archaea community, and decreased the diversity of the microbial community. Slurry reflux also reduced the tendency of the enrichment of Chloroflexi and the relative abundance of Methanothrix. The increase of OLR changed the main methanogenic pathway in the anaerobic digestion system, slurry reflux could slow down this trend.

Applied & Industrial Microbiology

General Microbiology

Slurry reflux

Corn stalk

Anaerobic digestion

Methane

Microbial community

China is rich in crop stalk resources, with an annual output of approximately 850 million tons (Li et al., 2016a); however, the utilization rate of these resources is relatively low (Du et al., 2017). Nearly 50% of the crop stalk are used for fuel and incineration annually, which caused environmental pollution as well as considerable wastage of resources. As an engineering solution to degrade organic waste and produce biogas, AD is considered a sustainable and effective approach to treat waste, generate clean energy, and recycle organic matter by utilizing stalk energy (Yanjin et al., 2020). However, the production of methane by AD also produced a large amount of slurry, which was rich in nitrogen, phosphorus, potassium, and other nutrients (Lu et al., 2010). If the slurry was not properly utilized and disposed of, it would inevitably cause secondary pollution (Chen et al., 2013; Qiu et al., 2016). Slurry reflux was an efficient and inexpensive treatment for slurry, which effectively reduced the amount of slurry that was discharged, as well as the subsequent disposal cost. Slurry reflux was therefore an efficient and inexpensive way to reduce emissions from the anaerobic digestion system, which in turn, can effectively reduce the slurry discharge and the subsequent disposal cost (Wu et al., 2018). Compared with an AD system where animal manure was used as the substrate, an anaerobic digestion system with crop stalk as the primary substrate lacks nutrients and buffering capacity (Zheng et al., 2020). Through slurry reflux, the basicity of the slurry could be used to balance the acidity of the digestion liquid, to maintain the pH value within an appropriate range. Additionally, slurry reflux can improve the number and activity of microorganisms in an AD system (Hu et al., 2014; Yang et al., 2016).

The biogas-production efficiency and system stability of the AD system depend largely on the activity of functional flora, while the diversity and richness of the microbial community can also affected its performance (Razaviarani & Buchanan, 2015). In AD process, the stages of acid production, acetic acid production, and methane production were completed by different functional flora (Li et al., 2018). By studying the community structure of bacteria and archaea in anaerobic digestion, the internal relationship and interaction between functional flora and anaerobic digestion performance can be obtained (Abbassi-Guendouz et al., 2012; Rui et al., 2015). Maria et al.(2017) reported the microbial community structure of an AD slurry reflux system, showing that Firmicutes and Bacteroidetes were dominant, while the dominant groups of archaea were Methanosarcina (Acidophilic and Hydrogenotrophic Methanogens) and Methanobacteria (Hydrogenotrophic Methanogens). Li et al. (2018) used corn stalk as a substrate to carry out AD with slurry reflux and found that the system was enriched in Bacteroidetes and Firmicutes. Gulhane et al. (2017) reported that the recycling of sewage increased the number of hydrolyzing and fermenting microorganisms that consume volatile fatty acids (VFAs). Different AD substrates determine the species and abundance of bacteria in the system, which would also lead to differences in the activities of various enzymes (Rui et al., 2015). Microbial characteristics could not only provide an early warning of system stability but also revealed the AD mechanism of the system (Abbassi-Guendouz et al., 2012; Rui et al., 2015). Currently, there was a lack of research on the continuous AD of corn stalk, especially relating to the role of bacteria in restoring system function after a sudden increase in OLR. Therefore, this study examined system stability and the influence of the microbial community, using an AD system which incorporated slurry reflux. Corn stalk were used as the substrate, and various organic load rate (OLR) were set. This study aimed to provide a scientific basis for the application of slurry reflux in biogas engineering technology.

2.1.Substrates and Inoculum

Corn stalks were obtained from the Beishan Scientific Research Base of Shenyang Agricultural University. The inoculum was obtained from the anaerobic digestion pond of the Comprehensive Energy Demonstration Base of Shenyang Agricultural University. The physicochemical parameters of the corn stalks and inoculum were shown in Table 1.

Table 1

Physicochemical properties of corn stalks and inoculum
Parameters	Corn Stalk	Inoculum
TS (%)	90.23 ± 0.07	17.46 ± 0.12
VS (%)	84.62 ± 0.04	6.12 ± 0.08
C (%)	42.75 ± 0.21	11.32 ± 0.14
N (%)	0.75 ± 0.07	0.77 ± 0.09
pH	-	7.60 ± 0.1

2.2.Experimental Digester and Setup

A Continuous Stirred Tank Reactor (CSTR) was used as the test device (Fig. 1).The total volume of the reactor was 10 L(working volume 8 L), the temperature was set at (37 ± 1) °C, and total solid (TS) content was 10%, and the mixing ratio of inoculum and substrate was 1:3 (calculated from the total dry weight of the material). Reflux was carried out once every 3 d; after the material was filtered. Up to 75% leachate was taken from the reflux group (R2) to make up for the water and was mixed with corn stalk, while water was used instead of the non-reflux group (R1). The test was conducted using an intermittent stirring method; stirring was carried out for 20 min every 2 h, and the rotating speed was set at 30 r/min. The first 10 days of the process comprised the start-up period (no data). Slurry reflux started on day 11, and was conducted for 81 days. According to the different OLRs, the test was divided into three phases: Phase Ⅰ (0–27 d after reflux) had an OLR of 2.0 gTS/(L·d), Phase Ⅱ (28–54 d after reflux) had an OLR of 3.0 gTS/(L·d), and Phase Ⅲ (55–81 d after reflux) had an OLR of 4.0 gTS/(L·d).

2.3.Analytical Techniques and Statistical Method

The pH values, total solid (TS) and volatile solid (VS) concentrations were measured according to the Standard Methods (APHA, 2012). The oxidation reduction potential (ORP) was measured using a Hach HQ40D multi-parameter water quality analyzer. A portable biogas analyzer was used for compositional analysis of the biogas. VFA concentrations were determined using gas chromatography on an FID detector 19091N-133 (30 m × 250 µm × 0.26 µm) column (Gu et al., 2014). Ammonia nitrogen was used for determination in the sodium reagent colorimetric method.

From the two groups of anaerobic digestion reactors with varying conditions, a total of six samples were selected for microbial community structure analysis and detection, these samples represented pre-reflux material (R1-1;R2-1), the end of Phase Ⅰ (R2-2), the end of Phase Ⅱ (R1-3;R2-3), and the end of Phase Ⅲ (R2-4).

The extraction of sample DNA was conducted following the instructions of the OMEGA E.Z.N.ATM Mag-Bind Soil DNA Kit. The diluted DNA samples were amplified using PCR (T100TM Thermal Cycler). Microbial amplification primers were 341F: 5'-CCCTACACGACGCTCTTCCGA TCTG (BARCODE) CCTACGGGNGGCWGCAG-3' and 805R: 5'-GACTGGAGTTCCTTGGCACCCGAGAA TTCCAGACTACHVGGGTA TCTAA TCC-3'. Archaea expansion increased 349 f: primers for 5'- CCCTACACGACGCTCTTCCGA TCTN (barcode) GYGCASCAGKCGMGAAW-3 and 806 r:' 5 'GACTGGAGTTCCTTGGCACCCGAGAA TTCCAGGACTACVSGGGTA TCTAA T-3'. PCR products with normal amplified fragments of bacteria and archaea above 400 bp were treated with 0.6 magnetic beads (Agencourt AMPure XP).

After treatment, the samples were sent to Shanghai Sangon Bioengineering Co., Ltd for sequencing. The detection types were bacteria and archaea, the platform was Miseq2 ×300 bp, and the library was the NCBI16S database. Operational taxonomic unit (OTU) clustering and species annotation were performed for more than 97% of the sequences, and Alpha diversity analysis and relative abundance analysis were also performed.

3.1.Influence of slurry reflux on methane production rate and cumulative methane production

The methane production rate was one of the important indicators for measuring the operating efficiency of the anaerobic digestion system. The methane production rate at each phase of the anaerobic digestion process was shown in Fig. 2(a), and the cumulative methane production at each phase was shown in Fig. 2(b).

In Phase Ⅰ, the methane production of R1 and R2 increased to a maximum and then decreased gradually, and the highest methane production rates were 234.78 mL/gTS and 250.73 mL/gTS, respectively. During Phase Ⅱ, the OLR was increased to 3 gTS/(L·d) and the methane production rate gradually increased. The maximum methane production rate reached 187.25 mL/gTS and 215.36 mL/gTS, respectively. In Phase Ⅲ, the OLR increased to 4 gTS/(L·d), and the average methane production rates in this phase were 100.41 mL/gTS and 171.21 mL/gTS, respectively, which decreased by 23.35% and 3.63% compared with that in Phase Ⅲ. It was worth noting that the methane production rate of R2 was better than that of R1 for the majority of the AD operation, and in R2 the average methane production rate was 45.8% higher than that of R1. The variation of methane production rate in the anaerobic digestion system was affected by both increased OLR and the slurry reflux. The methane production rate presented a downward trend with increasing OLR, and the implementation of slurry reflux could effectively alleviate this trend.

The cumulative methane production in Phase Ⅰ-Ⅲ, was 73.97 L, 84.88 L, and 86.76 L in R1 and 95.14 L, 115.12 L, and 147.92 L, in R2. The methane yield of R2 (363.30 L) was significantly higher than that of R1 (245.61 L), indicating that slurry reflux could promote methane production. During the three phases of operation in R2, the cumulative methane yield increased by 28.6%, 35.6%, and 70.5%, respectively, relative to R1. Slurry reflux enabled more complete degradation in the organic fermentation system, reduced the loss of microbes, and improved methane production. Such findings are consistent with those of previous studies (Li et al., 2018; Lu & You, 2015). However, Zhang. et al.(2018) and Zhang. et al.(2017) found that slurry reflux inhibited biogas production and reduced methane production. After preliminary analysis, they suggested that this might be caused by an increase in slurry viscosity and the accumulation of salt ions, during long-term operation of the slurry reflux process, and that this required further investigation. In this study, the system was operated for 91 days, and no significant reduction in methane production was observed.

3.2.Influence of slurry reflux on system stability

System stability is one of the key factors affecting the operation of the AD system. The variations in pH value, VFAs, ammonia nitrogen concentration, ORP, and other indexes (Fig. 3) indirectly reflected the stability of the AD system.

Prior to slurry reflux, VFA concentrations in R1 and R2 (Fig. 3b) were in a state of decline from continuous feeding, and the initial VFAs concentrations were 2310.99 mg/L and 2101.90 mg/L, respectively. With continuous feeding, the pH value of R1 (Fig. 3a) showed a low value of 6.39, while the pH value of R2 was relatively stable. On the 15th day of slurry reflux, the VFA concentration in R2 decreased to 142.79 mg/L, while in R1, it decreased to 194.73 mg/L on the 21st day. When the OLR was low, the effect of slurry reflux on the degradation of VFAs in the anaerobic digestion system was not obvious. In Phase Ⅱ, the concentration of VFAs was low in both groups of anaerobic digestion systems, At the beginning of Phase Ⅱ, although the increase in OLR caused a slight increase in the concentration of VFAs in R1, it soon became stable. In Phase Ⅲ, the OLR increased to 4 gTS/(L·d). Between 69–89 d, both experimental groups showed VFA concentration fluctuations, and the VFA concentration of R1 increased significantly. It was worth noting that the concentration of propionate (282.4 mg/L) during this phase was higher than the concentration of acetate (162.4 mg/L). Previous research has shown (Ying et al., 2014) that the ratio of acetate to propionate can be used as a system performance index; in an AD system when the concentration of propionate exceeded that of acetate by a certain threshold, it heralded a failure in the anaerobic digestion system (Wagner et al., 2014). At the same time, with the increase in VFAs concentration in R1, the pH value of R1 decreased from 7.11–5.92, which was beyond the suitable range of most methanogens. Anaerobic digestion was inhibited, as previously mentioned in the methane production analysis. R2 was maintained at pH 7.1, and there was no evident VFA accumulation under high OLR (4 gTS/(L·d)); slurry reflux improved the utilization rate of VFAs and the system stability. This was because the slurry reflux increased the microbial quantity of hydrolysis and fermentation in the AD system, which could consume VFAs (Gulhane et al., 2017). Although increases in OLR of the system caused local fluctuations in VFA concentrations, there was no accumulation of VFAs or inhibition of the AD system.

During the whole process of anaerobic digestion, the concentration of ammonia nitrogen (Fig. 3c) showed a decreasing trend, and was generally within 1500 mg/L; thus, it did not reach the inhibitory concentration and did not cause the accumulation of ammonia nitrogen. Although ammonia was an important index for measuring the nitrogen source in a system, previous studies have found that both high and low ammonia concentrations are not conducive to the growth and metabolism of microorganisms (Han et al., 2016; Yenigün & Demirel, 2013). An ammonia nitrogen concentration of 200 mg/L was significant for the microorganisms in the AD system, while concentrations that were too low do not meet the metabolic requirements of microorganisms. In the later phase of the anaerobic digestion process, the concentration of ammonia nitrogen was generally stable and fluctuated around 200 mg/L, which was similar to the results of previous research (Zhang et al., 2017).

During 9–45 d, the ORP of R1 (Fig. 3d) was at a stable stage (-405.71 ± 15 mV). The ORP in R2 was lower than this (-342 ± 5 mV). As the experiment went on, the ORP of R1 began to increase gradually. When the OLR was increased to 4 gTS/(L·d) in Phase Ⅲ, the ORP of R1 exceeded that of R2, which might be related to the increase in VFA concentration in R1. On the contrary, slurry reflux could improve the stability of the system so that the ORP of R2 was always within the appropriate range, and the average values of the three stages were − 347.9 mV, -336.9 mV, and − 331.1 mV, respectively.

3.3.Microbial community structure before and after slurry reflux

3.3.1.Analysis of microbial community diversity and richness

Microorganism methods, based on high-throughput sequencing, could return fairly complete DNA sequences and provide useful and tractable information about the microbial community, and have been widely used to analyze microbial activity during the anaerobic digestion process (Li et al., 2016b; Ying et al., 2014). The methane production and stability of the AD system depended largely on the activity of the microbial community structure. The diversity and richness of the microbial community affected the performance of the AD system (Razaviarani & Buchanan, 2015). Changes to operating conditions of the anaerobic digestion reactor also had significant effects on the microbial community structure (Si et al., 2016) in OTUs with a similarity level of 97%. A comparison of Alpha diversity, of anaerobic digestion bacteria in the no reflux and reflux groups, was shown in Table 2.

Table 2

Alpha diversity index of bacteria during reflux
Groups	R1-1	R1-3	R2-1	R2-2	R2-3	R2-4
Seq num	50509	58538	55398	43665	22254	40155
OTUs	1227	1133	1284	1105	1116	1354
Ace	1494.53	1386.81	1468.03	1434.84	1992.30	175.42
Shannon	4.59	4.54	4.55	4.55	4.26	3.98
Chao1	1406.35	1332.23	1414.02	1357.67	1514.35	1543.50

By comparing the Shannon and Chao1 index of the groups without slurry reflux (R1-1, R1-3) with those of the slurry reflux group (R2-1, R2-3), it was clear that with increasing AD operation time, R1 and R2 both exhibited a reduction in bacterial community diversity compared to the initial phase, of 1.1% and 6.4%, respectively. The Chao1 of R1 decreased by 5.3%, and that of R2 increased by 7.1%. The diversity of the bacterial community decreased gradually, while the richness of the bacterial community increased continuously. In conclusion, slurry reflux promoted the evolution of bacterial community structure in the AD system, and increased the bacterial community richness, which was consistent with the results of previous studies (Gulhane et al., 2017; Li et al., 2018).

The alpha diversity of archaea in the anaerobic digestion system was shown in Table 3. The diversity of arctic communities in the non-reflux group (R1-1, R1-3) and the reflux group (R2-1, R2-3) increased by 39.0% and 19.6%, respectively. According to the Chao1 index, among archaea, the richness of R1 increased by 37.9%, while that of R2 decreased by 17.6%.

Table 3

Alpha diversity index of archaea before and after slurry reflux.
Groups	R1-1	R1-3	R2-1	R2-2	R2-3	R2-4
Seq num	35502	72156	66784	79634	59710	66585
OTUs	141	219	150	159	108	212
Ace	271.08	420089	294.22	234.75	273.60	356.38
Shannon	1.59	2.21	1.63	1.92	1.95	2.02
Chao1	220.50	304.00	211.22	209.32	174.00	277.54

It could be seen from the indexes in Table 3 that the richness and diversity of bacteria in the AD system were higher than those of archaea, which was mainly caused by the difference in genetic diversity between bacteria and archaea (Guo et al., 2014). The diversity and richness of bacterial and archaeal communities were correlated with the stability of the system. The disappearance of bacterial populations indicated the disappearance of bacterial stratification and reduced evolution of new communities, which was a successful expression of the biochemical activity of the anaerobic system. However, further studies were needed to clarify the relationship between the stability of the anaerobic system and the composition of the microbial communities.

3.3.2.Bacterial community compositions

The relative abundance of bacterial communities at the phylum level was shown in Fig. 4.

As could be seen from Fig. 4, there were six dominant phyla in this study, namely Bacteroidetes, Firmicutes, Proteobacteria, Chloroflexi, Errucomicrobia, and Synergistetes, which together accounted for 83.14–91.75% of the total phyla level. Firmicutes and Bacteroidetes were the dominant phyla in the two experimental groups, and their relative abundance accounted for 43.29–63.62% of the total level.

Bacteroidetes were important hydrolytic, acid-producing, and fermentation bacteria, with several functions in the AD process (Weber, 2015). As the experiment progressed, the non-reflux group (R1-1; R1-3) and reflux group (R2-1; R2-3) showed a decreasing trend in the relative abundance of Bacteroidetes, particularly in R2-3, while the relative abundance was higher (23.27%) in the reflux group (R2-3) was higher, which indicated that operating the AD system with slurry reflux resulted in better hydrolytic acidification (Regueiro et al., 2012).

Firmicutes played an important role in various cellulose degradation processes, which could produce cellulases, proteases, and various extracellular hydrolases that degrade organic matter, and their main functions were to degrade cellulose and long-chain fatty acids and hydrolyze organic matter (Gang & Irini, 2014; Jiabao et al., 2015; Min et al., 2014; Tian et al., 2017). Many of the known syntrophic acetate-oxidizing bacteria (SAOB) belonged to the phylum Clostridia (R. et al., 2012; Sun et al., 2016; Kong et al., 2018). The relative abundance of Firmicutes in the non-reflux group (R1-1, R1-3) and the reflux group (R2-1, R2-3) exhibited little variation during the experiment, and were 36.24%, 32.83% and 23.35%, 21.12%, respectively.

In addition, compared with the non-reflux group (R1-1, R1-3), the relative abundance of Proteobacteria in the reflux group (R2-1, R2-3) was 17.46% and 7.5%. The relative abundance of Proteobacteria showed a downward trend, and was higher in the reflux group than in the non-reflux group (2.4%). The relative abundance of Chloroflexi in the non-reflow group (R1-1, R1-3) and the reflow group (R2-1, R2-3) was 1.1%, 15.29%, and 16.05%, 29.52%, respectively. The relative abundance of Chloroflexi continued to increase, which was promoted by the slurry reflux.

The community structure and relative abundance of bacteria in the reflux group (R2-1, R2-2, R2-3, and R2-4) were shown in Fig. 4. When OLR increased from 2 gTS/(L·d) to 4 gTS/(L·d), the relative abundance of Bacteroidetes first decreased before increasing, which was opposite to the reaction exhibited by Proteobacteria. Firmicutes decreased from 23.35–14.57% during the anaerobic digestion process. With the increasing in OLRs, the peak value of Verrucomicrobia reached 25.84% at the end of process, and the relative abundance of Verrucomicrobia increased by 23.16% compared with the initial phase (R2-1). Chloroflexi reached a maximum when OLR was 3 gTS/(L·d). The relative abundance of Chloroflexi during the four phases was 16.05%, 23.36%, 29.52%, and 13.52%, respectively. The relative abundance of each microbial community changed significantly, indicating that the bacterial community structure was significantly affected by the OLR (Jing et al., 2019).

3.3.3.Archaeal community compositions

Only 1% of the archaea in the system belonged to an unknown phylum, and there were no unknown archaea resources in AD system. Methanogens had two main dominant microorganisms at the phylum level (Fig. 5a), Euryarchaeota and Crenarchaeota. Among them, Euryarchaeota was the dominant methanogen (Li et al., 2018; Tian et al., 2017), with relative abundances of 89.32% and 87.45% in the non-reflux group (R1-1, R1-3) and 71.83% and 63.53% in the reflux group (R2-1, R2-3), respectively. The relative abundances of the second-most dominant phyla, Crenarchaeota, were 10.63%, 12.49% and 27.99%, 36.43% in the non-reflux group (R1-1, R1-3) and the reflux group (R2-1, R2-3), respectively.

At the genus level (Fig. 5b), the dominant archaea included Methanothrix, Methanospirillum, Methanobacterium, Methanosphaerula, and Methanomassiliicoccus. Methanothrix belonged to the actotrophic methanogens, which could convert organic acids into methane. The relative abundances of Methanothrix in the non-reflux group (R1-1, R1-3) and the reflux group (R2-1, R2-3) were 58.24%, 15.34%, and 53.44%, 38.76%, respectively. During the AD process, the reflux group (R2-3) had a higher relative abundance of Methanothrix than the non-reflux group (R1-3), which might be due to the continuous effluent in the non-reflux group system and the lower VFA content.

Methanospirillum, Methanobacterium, Methanosphaerula, and Methanomassiliicoccus all belong to the hydrotrophic methanogens (Bassani et al., 2017; Girma et al., 2017; Ilaria et al., 2015; Lee et al., 2017). With increased OLR, the combined relative abundances of the four species in the non-reflux group (R1-1, R1-3) and reflux group (R2-1, R2-3) were 29.79%, 68.05%, and 17.17%, 24.14%, respectively. Hydrotrophic methanogens were dominant in the non-reflux group (R1-3), while methanogens in the reflux group (R2-3) were still mainly actotrophic methanogens. This was because the increase in OLR changed the main methanogens pathway in the AD system, and slurry reflux would slow down this trend. Additionally, analysis of the relative abundance of bacteria (Fig. 4) also confirmed this, as the relative abundance of Firmicutes, which contained many known SAOB, was higher in R1 than in R2. It exhibited a reciprocal relationship with hydrotrophic methanogens, which could convert acetate into H₂ and CO₂ to generate methane (Zhu et al., 2019).

The structure of archaea at genus levels, during the different phases, was shown in Fig. 5. The relative abundance of Methanothrix in the reflux group was 53.44%, 45.16%, 38.76%, and 41.75%, respectively. The main methane-producing pathway was always the acetophilic pathway, but the increase in OLR changed the relative abundance of Methanothrix (Jing et al., 2019). The second-most dominant archaea were Crenarchaeota. In the process of slurry reflux, the relative abundance of Crenarchaeota exhibited an increasing trend, reaching the highest value (36.48%) in R2-3. When the OLR reached 4 gTS/(d·L) (R2-4), the relative abundance began to decline rapidly to 16.2%. In R2, the relative abundance of hydrogentrophic methanogens increased with the increase in OLR throughout the AD process, reaching 40.68% at the end of the reaction (R2-4), which was consistent with previous studies (D et al., 2014; Ros et al., 2017). Under high OLR conditions, hydrogentrophic methanogens occupied the dominant position in the whole anaerobic system.

Slurry reflux improved the system performance of AD, reduce the discharge of slurry and increase the methane production rate. The utilization of VFAs was improved by the slurry reflux; pH and ORP were maintained in the suitable range, which showed significant increase in the system stability of AD. The concentration of ammonia nitrogen decreased gradually. Results from high-throughput sequencing technique for microbial analysis indicated slurry reflux increased the richness of bacterial and archaea community and decreased the diversity of community. The dominant bacteria did not change significantly, the increase of organic load changed the main methanogenic pathway in the AD system, slurry reflux could slow down this trend.

CSTR: Continuous stirred tank reactor; OUT: Operational taxonomic unit; VFAs: Volatile fatty acids; ORP: Oxidation-reduction potential; TS: Total solid; VS: Volatile solid; OLR: Organic loading rate

Authors’contributions

LZ performed the experiments and analyzed the raw data. YG conceived the study, designed the experiments and drafted the manuscript. JMZ , JXS and ZW participated in the design of the study. carried out the model analysis, and JYL and WK helped to perform the experiments. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

All data are fully available without restriction.

Ethics approval and consent to participate

No animal or human subjects were used in this work.

Funding

This study was supported by the Natural Science Foundation of Liaoning (Grant 2019-ZD-0716).

Notes

The authors declare no competing financial interest.

Declarations

Consent for publication

Not applicable

Acknowledgment

This study was supported by the Natural Science Foundation of Liaoning (Grant 2019-ZD-0716).

Abbassi-Guendouz, A., Brockmann, D., Trably, E., Dumas, C., Delgenès, J.-P., Steyer, J.-P., Escudié, R. 2012. Total solids content drives high solid anaerobic digestion via mass transfer limitation [J] Bioresource Technology. 111,55-61.

Bassani, I., Kougias, P.G., Treu, L., Porté, H., Campanaro, S., Angelidaki, I. 2017. Optimization of hydrogen dispersion in thermophilic up-flow reactors for ex situ biogas upgrading [J] Bioresource Technology. 234,310-319.

Chen,C.;Ruan,Z.Y.;Wu,J.;Gao,L.H.;Song,J.L.;Wang,Y.W.;Xu,Y.S.;Wei,X.L.;Xu,F.H.2013.Research Progress on the Comprehensive Disposal and Utilization of Biogas Slurry from Large Scale Biogas Engineering. China Biogas. 31 (01), 25-28+43.

Du, H.; Zhang,Y.X.; Zhang,X.Y.; He,Z.; Mao,W.W. 2017. Bibliometric Analysis on the Research Status and Development of Straw Utilization in China. JOURNAL OF LIAONING UNIVERSITY.44 (02), 162-170.

D, Y., M, K.J., K, L., M, K., A, S., M, R. 2014. Biogas production and methanogenic archaeal community in mesophilic and thermophilic anaerobic co-digestion processes. [J] Journal of environmental management. 143,54-60.

Gang, L., Irini, A. 2014. Analysis of bacterial communities and bacterial pathogens in a biogas plant by the combination of ethidium monoazide, PCR and Ion Torrent sequencing. [J] Water research. 60,156-163.

Girma, M.D., Freya, M., James, W.A., Daniela, P., Markus, G., Frank, K., Lund, N.J., Anders, F. 2017. Exogenous addition of H₂ for an in situ biogas upgrading through biological reduction of carbon dioxide into methane. [J] Waste management (New York, N.Y.). 68,146-156.

Gulhane, M., Pandit, P., Khardenavis, A., Singh, D., Purohit, H. 2017. Study of microbial community plasticity for anaerobic digestion of vegetable waste in Anaerobic Baffled Reactor [J] Renewable Energy. 101,59-66.

Gu,F.Q.;Xu,H.J.;Liu,Z.F.;Chen,G.Teng,F.2014. Content of 6 Volatile Fatty Alidiod Waste watei by Gas Chromato Graphy GC. Energy Environmental Protection. 28 (03), 62-64.

Guo, X., Wang, C., Sun, F., Zhu, W., Wu, W. 2014. A comparison of microbial characteristics between the thermophilic and mesophilic anaerobic digesters exposed to elevated food waste loadings [J] Bioresource Technology. 152,420-428.

Han, W., Yifeng, Z., Irini, A. 2016. Ammonia inhibition on hydrogen enriched anaerobic digestion of manure under mesophilic and thermophilic conditions. [J] Water research. 105,90-121.

Hu, Y., Shen, F., Yuan, H., Zou, D., Pang, Y., Liu, Y., Zhu, B., Chufo, W.A., Jaffar, M., Li, X. 2014. Influence of recirculation of liquid fraction of the digestate (LFD) on maize stover anaerobic digestion [J] Biosystems Engineering. 127,189-196.

Ilaria, B., G, K.P., Laura, T., Irini, A. 2015. Biogas Upgrading via Hydrogenotrophic Methanogenesis in Two-Stage Continuous Stirred Tank Reactors at Mesophilic and Thermophilic Conditions. [J] Environmental science & technology. 49(20),12585-12593.

Jiabao, L., Junpeng, R., Minjie, Y., Shiheng, Z., Xuefeng, Y., Yuanpeng, W., Zhiying, Y., Xiangzhen, L. 2015. Substrate Type and Free Ammonia Determine Bacterial Community Structure in Full-Scale Mesophilic Anaerobic Digesters Treating Cattle or Swine Manure [J] Frontiers in Microbiology,1-10.

Jing, N., Mingdian, Z., Xiaofang, P., Chunxing, L., Nan, L., Tao, W., Guanjing, C., Ruming, W., Junjie, L., Gefu, Z. 2019. Simultaneous biogas and biogas slurry production from co-digestion of pig manure and corn straw: Performance optimization and microbial community shift. [J] Bioresource technology. 282,37-47.

Kong,D.W.;Zhang,K.Q.;Fang,F.;Gao,W.X.;Liang,J.F.;Liang,Y.;Du,L.Z.2018. Study of microbial community and biogas production in anaerobic digestion of pig manure with digested slurry recirculation. Journal of Agro-Environment Science. 37 (03), 559-566.

Lee, B., Park, J.-G., Shin, W.-B., Tian, D.-J., Jun, H.-B. 2017. Microbial communities change in an anaerobic digestion after application of microbial electrolysis cells [J] Bioresource Technology. 234,273-280.

Lei, L.; Qingming, H; Yunmei, W.; Qin, H.; Xuya P. Early warning indicators for monitoring

the process failure of anaerobic digestion system of food waste. Bioresource Technology. 2014, 171,491-494.

Li, K., Liu, R., Sun, C. 2016a. A review of methane production from agricultural residues in China [J] Renewable and Sustainable Energy Reviews. 54,857-865.

Li, X., Guo, J., Dong, R., Ahring, B.K., Zhang, W. 2016b. Properties of plant nutrient: Comparison of two nutrient recovery techniques using liquid fraction of digestate from anaerobic digester treating pig manure [J] Xin Li;Jianbin Guo;Renjie Dong;Birgitte K. Ahring;Wanqin Zhang. 544,774-781.

Li, Y., Liu, C., Wachemo, A.C., Li, X. 2018. Effects of liquid fraction of digestate recirculation on system performance and microbial community structure during serial anaerobic digestion of completely stirred tank reactors for corn stover [J] Energy. 160,309-317.

Lu, J., Zhu, L., Hu, G., Wu, J. 2010. Integrating animal manure-based bioenergy production with invasive species control: A case study at Tongren Pig Farm in China [J] Biomass and Bioenergy. 34(6),821-827.

Lu,Y.J.;You,Y.J.2015. Influence of Biogas Slurry Reflux on Anaerobic Biogas Project. China Biogas. 33 (03), 66-68.

Luo, G.; Angelidaki, I. Co-digestion of manure and whey for in situ biogas upgrading by the

addition of H2 : process performance and microbial insights. Springer-Verlag. 2013, 97 (3),1373-1381.

Maria, F.D., Barratta, M., Bianconi, F., Placidi, P., Passeri, D. 2017. Solid anaerobic digestion batch with liquid digestate recirculation and wet anaerobic digestion of organic waste: Comparison of system performances and identification of microbial guilds [J] Waste Management. 59,172-180.

Min, J.H., Hyun, K.J., Hyub, H.J., Moon, P.J. 2014. Bacterial and methanogenic archaeal communities during the single-stage anaerobic digestion of high-strength food wastewater. [J] Bioresource technology. 165,174-182.

Qiu,S.; Zhao,L.B.; Ma,F.;Sun,Y. The influence of aeration rate on intermittent forcedaeration composting of biogas residue. China Environmental Science. 2016, 36 (08), 2402-2408.

R., S.J., J., M.M., P., G.R. 2012. Genomic Insights into Syntrophy: The Paradigm for Anaerobic Metabolic Cooperation [J] Annual Review of Microbiology. 66,429-452.

Razaviarani, V., Buchanan, I.D. 2015. Anaerobic co-digestion of biodiesel waste glycerin with municipal wastewater sludge: Microbial community structure dynamics and reactor performance [J] Bioresource Technology. 182,8-17.

Regueiro, L., Veiga, P., Figueroa, M., Alonso-Gutierrez, J., Stams, A.J.M., Lema, J.M., Carballa, M. 2012. Relationship between microbial activity and microbial community structure in six full-scale anaerobic digesters [J] Microbiological Research. 167(10),581-589.

Ros, M., Filho, J.d.S.O., Murcia, M.D.P., Bustamante, M.A., Moral, R., Coll, M.D., Santisima-Trinidad, A.B.L., Pascual, J.A. 2017. Mesophilic anaerobic digestion of pig slurry and fruit and vegetable waste: Dissection of the microbial community structure [J] Journal of Cleaner Production. 156,757-765.

Rui, J., Li, J., Zhang, S., Yan, X., Wang, Y., Li, X. 2015. The core populations and co-occurrence patterns of prokaryotic communities in household biogas digesters [J] Biotechnology for Biofuels. 8(1),3-15.

Si, B., Liu, Z., Zhang, Y., Li, J., Shen, R., Zhu, Z., Xing, X. 2016. Towards biohythane production from biomass: Influence of operational stage on anaerobic fermentation and microbial community [J] International Journal of Hydrogen Energy. 41(7),4429-4438.

Sun, L., Liu, T., Müller, B., Schnürer, A. 2016. The microbial community structure in industrial biogas plants influences the degradation rate of straw and cellulose in batch tests [J] Biotechnology for Biofuels. 9(1),2-20.

Tian, G., Zhang, W., Dong, M., Yang, B., Zhu, R., Yin, F., Zhao, X., Wang, Y., Xiao, W., Wang, Q., Cui, X. 2017. Metabolic pathway analysis based on high-throughput sequencing in a batch biogas production process [J] Energy. 139,571-579.

Wagner, A.O., Reitschuler, C., Illmer, P. 2014. Effect of different acetate:propionate ratios on the methanogenic community during thermophilic anaerobic digestion in batch experiments [J] Biochemical Engineering Journal. 90,154-161.

Weber, C.F. 2015. Reduced vertical stratification of soil bacterial community structure and composition is associated with Bromus tectorum invasion of sagebrush steppe [J] Journal of Arid Environments. 115,90-99.

Wu, C., Huang, Q., Yu, M., Ren, Y., Wang, Q., Sakai, K. 2018. Effects of digestate recirculation on a two-stage anaerobic digestion system, particularly focusing on metabolite correlation analysis [J] Bioresource Technology. 251,40-48.

Yanjin, W., Zhenfeng, W., Quanguo, Z., Gaoshen, L., Chenxi, X. 2020. Comparison of bio-hydrogen and bio-methane production performance in continuous two-phase anaerobic fermentation system between co-digestion and digestate recirculation [J] Bioresource Technology. 318,124269.

Yang,Q.;Ju,M.T.;Li,W.Z.2016. Review of methane production from straws anaerobic digestion. Transactions of the Chinese Society of Agricultural Engineering. 32 (14), 232-242.

Yenigün, O., Demirel, B. 2013. Ammonia inhibition in anaerobic digestion: A review [J] Process Biochemistry. 48(5-6),901-911.

Ying, Y., Ke, Y., Yu, X., K, L.F.T., W, T.D.T., Cheong, F.W., P, F.H.H., Tong, Z. 2014. Metagenomic analysis of sludge from full-scale anaerobic digesters operated in municipal wastewater treatment plants. [J] Applied microbiology and biotechnology. 98(12),5709-5718.

Zhang,H.;Wang,W.Z.;Yuan,X.F.;Li,Q.Z.;Yang,Z.X. 2018. Effect of Slurry Recirculation on Methane Production of Cotton Stalk and Its microflora. China Biogas. 36 (01), 19-25.

Zhang,Y.P.;Chen,G.Y.;Hei,K.L.;Yang,Y.F.Xu,C.Y.;Chang,Z.Z. 2017. Effects of Full Continuous Reflux of Biogas Slurry on Characteristics of Rice Straw Anaerobic Digestion. Journal of Ecology and Rural Environment. 33 (09), 845-851.

Zheng, Z., Cai, Y., Zhao, Y., Meng, X., Zhang, Y., Lu, C., Hu, Y., Cui, Z., Wang, X. 2020. Achieve clean and efficient biomethane production by matching between digestate recirculation and straw-to-manure feeding ratios [J] Journal of Cleaner Production. 263,121414.

Zhi,Z. 2021.Analysis on the Present Situation and Predicament of High-value Utilization of Agricultural Straw in China. Journal of Agricultural Science and Technolgy. 23(2),9-16.

Zhu, X., Cao, Q., Chen, Y., Sun, X., Liu, X., Li, D. 2019. Effects of mixing and sodium formate on thermophilic in-situ biogas upgrading by H₂ addition [J] Journal of Cleaner Production. 216,373-381.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Effects of slurry reflux on the stability and microbial community structure of corn stalk anaerobic digestion system

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

3. Results

4. Discussion

Abbreviations

Declarations

References

Status:

Version 1