Tissue samples
Primary invasive ductal carcinomas tissues and adjacent normal tissues were obtained from female patients at the Jinling Hospital, affiliated with the Medical School of Nanjing University. All participants didn’t receive neoadjuvant therapies before the operation. A total of 147 female patients participated in this study. The written informed consent had been collected from patients before the study. The investigation was approved by the ethics committee of Jinling Hospital.
Cell culture and treatment
SK-BR-3, MCF-7 and MDA-MB-231 cell lines used in this study were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). MCF-10A (normal human mammary epithelial cell line) purchased from KeyGEN Biotech Company (Nanjing, China) was used as the control cell line. All cell lines were grown in Dulbecco’s Modified Eagle’s medium (DMEM, KeyGEN) in which 10% fetal bovine serum (A3160801, Gibco) and 1% penicillin-streptomycin were added. Cell culture was accomplished in a humidified incubator containing 5% CO2 at 37 °C. Cell passage was performed when the confluence reached to 90%. Reagents used in this study, including TGF-β1 and TGF-β type I Receptor inhibitor SB431542, were separately purchased from PeproTech (#100-21, USA) and MedChemExpress (HY-10431, USA).
Plasmid construction
FZD2 was overexpressed in MCF-7 cells by using the GV141 vector (Genechem, China). The obtained fragments were digested using the XhoI/KpnI restriction enzymes. At 48 h post-transfection, cells were reaped. The FZD2 cDNA was PCR amplified using the following primers: Forward: ACGGGCCCTCTAGACTCGAGCGCCACCATGCGGCCCCGCAGCGCCCTGCCCCGC; Reverse: AGTCACTTAAGCTTGGTACCGACACGGTGGTCTCACCGTGTCGGC.
siRNA Transfection
siRNAs targeting FZD2 were designed and synthesized by Ribobio (Guangzhou, China). For the silencing of FZD2, siRNAs were transfected into SK-BR-3 and MDA-MB-231 cells in accordance with the instruction manual for Lipofectamine 3000 (Invitrogen, #L3000015, Carlsbad, CA, USA). Plasmid amplification was accomplished through transformation and pumping. The levels of FZD2 mRNA and protein were separately checked by qRT-PCR and western blot. Sequences for all siRNAs are as follows:
si-FZD2-1
|
CATCCTATCTCAGCTACAA
|
si-FZD2-2
|
CCATCATGCCCAACCTTCT
|
si-FZD2-3
|
CCCGATGGTTCCATGTTCT
|
RNA extraction and qRT-PCR
Total RNA was extracted from tissues with RNA kit (Promega), whereas those extracted from cells were accomplished with TRIzol (Invitrogen). RNA was reverse transcribed into cDNA using PrimeScript RT Master Mix (Perfect Real Time, TaKaRa, Shiga, Japan) and then analyzed by qRT-PCR with SYBR Green Master Mix on an Applied biosystem 7500 machine (USA). 2−ΔΔCT method was used to calculate relative mRNA expression by normalizing to GAPDH. Sequences for all primers used for qRT-PCR were provided in Table 1.
Western blot
RIPA buffer (Beyotime) was used for extraction of total protein from tissues and cells. BCA Protein Assay Kit (KeyGen Biotech, Nanjing, China) was applied to measure the protein concentration. After resolved on SDS-PAGE, the protein lysates were transferred onto a polyvinylidene fluoride (PVDF) membrane (Immobilon, USA). After blocked in 5% non-fat milk, the membranes were incubated with primary antibodies at 4°C overnight. After washing, the membranes were incubated with a secondary antibody against rabbit (1: 5000, Abcam) at 37°C for 1 h. Primary antibodies used in this experiment were shown in Table 2. The blots were detected by the ECL (NCM Biotech, China) method.
Immunohistochemistry (IHC)
hesFor IHC staining, sections were dewaxed with xylene and rehydrated in ethanol. To avoid non-specific staining, samples were washed with PBS and blocked with 5% BSA at room temperature for 30 min. After washing, sections were incubated with primary antibodies against FZD2 (1:50, Abcam), TGF-β1 (1:500, Proteintech), Ki-67 (1:10000, Proteintech) at 4 °C overnight. Afterwards, sections were incubated with secondary antibody kit SP0031 and/or SP0021 (Solarbio, China) in accordance with the instruction manual. Images were taken under a microscope (Olympus CX41, Japan).
Evaluation of staining of tissue slides
After immunostaining, FZD2 in different tissues was evaluated by a semi-quantitative immunoreactivity scoring system (IRS). The indexes of Immunostaining intensity were separated as 0 (no immunostaining), 1 (weak), 2 (moderate) and 3 (strong). The scores for immunoreactive cells were separately defined as 0 (no immunoreactive cells), 1 (less than10%), 2 (between 10% and 50%), 3 (between 51% and 80%) and 4 (more than 80%). The IRS index for each case ranges from 0 to 12. FZD2 was considered to be upregulated in cases with 6 or higher IRS score, whereas FZD2 was considered to be downregulated in those with IRS score less than 6.
Cell counting kit 8 (CCK-8) assay
The transfected cells were plated into 96-well plates at 6-8 × 103 cells per well in 100 μL cell suspension. After added CCK-8 solution (10 μL) (Dojindo, Kumamoto, Japan) at six different time points (0 h, 24 h, 48 h, 72 h, 96 h, 120 h), cells were incubated at 37°C for 2 h. Finally, a microplate reader was applied to measure the absorbance at 450 nm (OD 450 nm).
Colony formation assay
The transfected cells were seeded in 6-well plates at 3 × 103 cells per well and cultured in DMEM containing 10% FBS. At day 14, cells were fixed with methanol for 10 min and stained by 0.1% crystal violet for 15 min. After captured the pictures, the number of colonies was recorded manually.
Cell migration and invasion assays
Matrigel-coated 24-well Transwell chambers (Corning Incorporated, Corning, NY, USA) and non-coated Transwell chambers (#353097; BD Biosciences, USA) were separately used for cell invasion assay and cell migration assay. Twenty-four hours after transfection, the cells were plated into the upper compartment containing serum-free DMEM at a density of 2× 104 cells per well. The lower chamber was added with DMEM containing 20% FBS. Forty-eight hours later, the cells in the upper chamber were removed with cotton swabs, while the cells on the lower surface were fixed with 4% paraform-aldehyde for 10 min and stained with 0.1% crystal violet for 15 min. The results were obtained using an inverted microscope (Olympus, Japan).
Wound healing assay
Twenty-four hours after siRNA transfection, cells were seeded in 6-well plates at a density of 1×106 cells each well. After cell attachment, a scratch was created with a 200 μL pipette tip in the cell layer. Cells that had been scraped off were washed away with PBS. Forty-eight hours later, the distance of wound was measured by observing images at 0 h and 48 h.
Flow cytometry analysis of cell cycle distribution
Twenty-four hours after siRNA transfection, cells were plated into 6-well plates at a density of 1 × 106 cells per well. Next, cells were rinsed in prepared phosphate buffer saline (PBS). After incubated with the propidium iodide (KeyGEN, China), flow cytometry was applied to detect the cell population at different phase (G0/G1, S and G2/M). Percent of cells in different phases was measured by BD FACSCantoII (BD Biosciences, USA).
Flow cytometry analysis of cell apoptosis
Twenty-four hours after siRNA transfection, EDTA-free trypsin (Beyotime, China) was used to digest the cells, and 1 × 106 cells/ml were counted. Cell apoptosis assay was processed under the FITC Annexin V Apoptosis Detection Kit (BD Biosciences), cell apoptosis was detected by BD FACSCanto II (BD Biosciences).
Immunofluorescence microscopy
Cells were fixed in parafolmaldehyde (4%) for 20 min and permeabilized with 0.5% Triton X-100 in PBS for 10 min. Cells were blocked with PBS/BSA 5% for 30 min. The membranes were incubated with primary antibody against E-cadherin and Vimentin (1: 50, proteintech) at 4°C overnight. After washing, the membranes were incubated with green-fluorescence conjugated Affinipure antibody (Coralite 488, diluted 1:100, Proteintech) or Red-fluorescence conjugated Affinipure antibody (Coralite 594, diluted 1:100, Proteintech). After washing, DAPI (Sigma, Cat# D-9542) was used for the nuclei staining. Images were visualized using a Nikon ECLIPSE NI (Japan) microscope.
Xenograft tumorigenicity assay
For animal study, female BALB/c nude mice (4 weeks old) were bought from the Comparative Medicine Department of Jinling Hospital. Mice were randomly divided into two groups (n=6 per group) after the tumor volume reached 100mm3. si-FZD2-2 and si-NC(Ribobio, China) was administered by intratumoral injection at a dose of 30 μL/piece, administered once every 3 days and continuously for 14 times. Forty days after injection, all mice were killed and the tumors were removed. Tumor tissues were embedded in paraffin for further analyses. Animal study was conducted followed the protocol of the animal ethics committee of Jinling Hospital.
TUNEL assay
Apoptosis in tumor tissues removed from nude mice was detected by using the TUNEL assay kit (Roche, USA) according to the manufacturer’s guidelines.
Statistical analysis
Statistical significance of differences was analyzed with two-tailed student’s t test (between two groups) or one-way/two-way ANOVA (among multiple groups). All experimental data were obtained from three or more independent experiments and shown as mean ± SD (standard deviation). The correlation between FZD2 expression and the clinicopathological characteristics of BC patients was analyzed using the Chi-squared test. SPSS v17.0 (SPSS Inc., Chicago, IL, USA) and Prism v8.0 (GraphPad, San Diego, CA, USA) were utilized for statistical analyses. Data were statistically significant when p values less than 0.05.