Sample Collection
5 patients underwent marsupialization combined enucleation later were included in this study, and the tissue sampling process was illustrated in Fig 1. Samples harvested before and after marsupialization were stored in 4% paraformaldehyde for 6-8 hours and high-glucose Dulbecco’s modified Eagle medium (DMEM; HyClone) supplemented with 100 U/ml penicillin and 100 mg/ml streptomycin (HyClone) at 4℃ up to 2 hours, respectively. Patients engaged in this trial aged between 18-25 years, who were diagnosed as DC both clinically and histologically. This work was approved by the Ethics Committee of Shanghai Ninth People’s Hospital, and all participants gave their informed consent.
Histological Analysis
Capsules fixed in 4% paraformaldehyde were embedded in paraffin and sliced for histological evaluation. Paraffin sections were stained with hematoxylin and eosin (H&E) as well as Safranin O/Fast Green. For immunofluorescent staining, after deparaffinization, rehydration, antigen retrieval, permeabilization and blocking non-specific binding, sections were incubated in primary antibodies against STRO-1 (Novus Biologicals; 1:100), ALP (Servicebio; 1:3000), COL1A1 (Servicebio; 1:800) at 4℃ overnight and secondary antibodies (Servicebio; 1:500) for 1 hour at room temperature. DAPI (Abcam) at 1:500 was used as nuclear counterstain. Results were detected by fluorescence microscope (Olympus).
Cell Culture
Fresh samples were rinsed with phosphate buffered saline (PBS) for three times and then gently minced into small pieces. The fragments were transferred to 12-well chambers (Coster) and 100-mm dishes (Corning) with complete medium — DMEM containing 10% fetal bovine serum (FBS; Every Green), 100 U/ml penicillin and 100 mg/ml streptomycin (HyClone). The glass cover slips were placed over the fragments to prevent floating. Cells were cultured at 37℃ with 5% CO2, and culture medium was changed twice a week. Bm-DCSCs and Am-DPSCs would be harvested and amplified when reaching 80-90% confluence, and passage P2-P4 were used in this work. The primary passage of Am-DCSCs on the glass cover slips in 12-well chambers were used for immunofluorescence staining.
Morphology & Surface marker
Immunofluorescence
The primary passage of cells in 12-well chambers were fixed in 4% paraformaldehyde for 30 minutes at room temperature. After that, Am-DCSCs were permeabilized in 0.3% Triton X-100 for 5 minutes and blocked in 5% BSA for 1 hour. Then, Am-DCSCs were incubated with antibodies against STRO-1 (Novus Biologicals) at 1:150 dilution at 4℃ overnight. Alexa Fluor-648-conjugated anti-IgM (Yeasen) was used as secondary antibody at 1:200 dilution and DAPI (Abcam; 1:500) was used for nuclear counterstain. Bm-DCSCs and Am-DCSCs at P3 were stained by Alexa Fluor 555 Phalloidin (Abcam; 1:200) and DAPI (Abcam; 1:500) as well for actin staining. Slides were examined with confocal laser scanning microscope (CLSM; Leica).
Flow Cytometry Analysis
Both Bm-DCSCs and Am-DCSCs were detached with 0.25% trypsin-EDTA (Gibco) for 20-30 seconds, washed twice by PBS, and centrifuged at 1000 rpm for 5 minutes. Cell surface markers, such as CD90-FITC, CD44-FITC, CD45-FITC, CD34-FITC, CD31-FITC were used to label the cells on ice for 30 minutes in the dark. Cell suspensions without the antibodies served as controls. DCSCs were washed twice and resuspended in 200μL PBS before analysis. All antibodies were purchased from BD Biosciences. Flow cytometry was performed with a flow cytometer (Beckman Coulter).
Multi-differentiation Assays
Bm-DCSCs and Am-DCSCs were seeded into 12-well plates and cultured in complete medium until 100% confluence. Osteogenic differentiation medium, including 2 mmol/L β-glycerophosphate (Sigma-Aldrich), 100 mmol/L L-ascorbic acid phosphate (Sigma-Aldrich), and 10 nmol/L dexamethasone in complete medium, was used for osteogenic induction. Adipogenic and chondrogenic induction were stimulated by commercial kits (Cyagen) according to manufacturer’s instructions. Osteogenesis effects were detected by Alkaline phosphatase (ALP; Beyotime) after 1, 3, 7 days and Alizarin red staining (ARS; Sigma-Aldrich) after 7, 14, 21 days, and the quantitative assays were performed at the same time. Besides, Oil Red O and Alcian blue were used for adipogenic and chondrogenic detection after 3-4 weeks’ induction.
Real Time PCR
The gene expression in Bm-DCSCs and Am-DCSCs after osteogenic differentiation were detected by Real Time PCR. Total RNA was extracted with RNAiso Plus (TaKaRa), and complementary DNA (cDNA) was synthesized using the PrimeScriptTM RT reagent kit (TaKaRa). The housekeeping gene GAPDH was used for normalization. Primers were synthesized commercially (Shengong). The sequences of the primers were as follows: GAPDH-CGACAGTCAGCCGCATCTT and CCAATACGACCAAATCCGTTG-3, BMP-2-ATGGATTCGTGGTGGAAGTG and GTGGAGTTCAGATGATCAGC, COL1A1-TCTGCGACAACGGCAAGGTG and GACGCCGGTGGTTTCTTGGT.
Immunofluorescence
The osteogenic protein expression of Bm-DCSCs and Am-DCSCs were detected by immunofluorescence. After 7 days’ osteogenic induction, cells were permeabilized in 0.3% Triton X-100 for 5 minutes and blocked in 5% BSA for 1 hour. Then, they were incubated with antibodies against osteocalcin (OCN; Abcam) and RUNX2 (CST) at 1:100 dilution at 4℃ overnight. After that, cells were incubated with secondary antibodies (1:500; Invitrogen) for 30min and subsequently incubated with DAPI (1:500; Abcam) for 5min at room temperature. Results were detected by fluorescence microscope (Olympus).
Proliferation & Self-renewal capacity
Cell Proliferation
Bm-DCSCs and Am-DCSCs were seeded in 96-well plates (Coster) at a density of 1000 cells per well. The cell number was assessed on days 1, 3, 5, 7, 9 and 11 with the Cell Counting Kit-8 (Dojindo Laboratories). The optical density was measured at a wavelength of 450 nm using the SparkTM 10M Multimode Microplate Reader (TECAN).
Colony-forming Unit
Cells were seeded in 6-well plates at a density of 100 cells per well. After 10 days’ culture, they were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet (Beyotime) for 5 minutes, and aggregates of 50 or more cells were scored as colonies.
EdU Assay
EdU Assay was detected by BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 555 (Beyotime). Firstly, Bm-DCSCs and Am-DCSCs were seeded in 12-well plates. 24 hours later, cells were labelled by EdU for 2 hours, and then, they were fixed and permeabilized. Solution for EdU detection was prepared according to the manual, and cells were analysed by fluorescence microscope. Besides, the number of EdU-positive cells was detected by flow cytometry for quantitative analysis.
Ectopic bone regeneration in vivo
Scanning electronic microscopy
Cells were seeded onto the surface of β-tricalcium phosphate (β-TCP; Shanghai Bio-Lu Biomaterials Co. Ltd.) at a density of 1.0 × 106 /ml. After incubation for 4 hours and 1 day, the scaffolds were fixed in 2.5% glutaraldehyde overnight at 4℃. Then, they were dehydrated through an ethanol gradient (30%, 50%, 70%, 90% and 100% for twice) for 10 minutes in each concentration. After that, they were transferred to the mixture of alcohol and iso-amyl acetate (V/V=1:1) for 30 minutes and pure iso-amyl acetate for 1 hour. Followed by critical point dryer with liquid CO2, samples were coated with gold sputter and images were collected by a scanning electron microscope.
In vivo ectopic transplantation model
β-tricalcium phosphate mixed with 5.0 × 106 of Bm-DCSCs or Am-DCSCs were transplanted into aseptically created subcutaneous pockets in 6-week-old immunocompromised mice under anesthesia via 2% sodium pentobarbital. β-TCP with PBS were seeded on the other side of dorsum in the same mice in order to serve as control group. Transplants were harvested after 8 weeks and assessed by histology.
The ability to repair bone defect in situ
Cranial bone defect model in immunocompromised mice
β-tricalcium phosphate were mixed with 5.0 × 106 of Bm-DCSCs or Am-DCSCs. Immunocompromised mice were anesthetized via 2% sodium pentobarbital. Then, a sagittal incision was created in the middle of the scalp. After exposing the calvarium, the periosteum was carefully deflected with ophthalmic forceps. A 5-mm size defect was made on the calvarium using a trephine with constant sterile saline cooling. Finally, the scaffold was implanted within the defect, and the periosteum as well as scalp were repositioned and sutured. β-TCP with PBS were served as control group. Transplants were harvested after 12 weeks and assessed by histology.
Sequential fluorescent labeling
To label the rate of new bone formation, sequential fluorescent labeling was carried out on 3 athymic mice from each group. They were intraperitoneally injected with 25 mg/kg hydrochloride tetracycline (TE, Sigma), 20 mg/kg calcein (CA, Sigma), and 30 mg/kg Alizarin Red S (AL, Sigma) at 3, 6 and 9 weeks after surgery, respectively. The calvarias were harvested at 12 weeks and used for non-decalcified tissue histomorphometric measurements. Mineral apposition rate (μm/day) was measured and evaluated.
Statistical Analysis
Results were presented as the mean ± standard deviation. The statistical analysis was performed using the GraphPad Prism statistical software package (Version 7.0). One-way ANOVA was performed, followed by Dunnett’s test for multiple comparisons (*: p<0.05; ***: p<0.001; ****: p<0.0001).