Subjects
The current case-control study was based on 400 unrelated patients with MIEH and 400 healthy control individuals in the Jiangsu Province of China. The MIEH patients were recruited according to the following inclusion criteria:
(1) in-patients or outpatients who have undergone regular medical check-up at the Department of Cardiology in Northern Jiangsu People’s Hospital from June 2009 to June 2016;
(2) more than 18 years old;
(3) with a diagnosis of primary hypertension;
(4) diagnosed with MIEH on the basis of the maternal transmission of EH within generations, which was transmitted by the mother or her relatives, rather than by the father.
Participants were excluded if they were diagnosed as follows:
(1)secondary hypertension (e.g. aortic coarctation, renal arterial stenosis, hyperaldosteronism, and pheochromocytoma);
(2) congenital cardiovascular disease;
(3) organic valve diseases.
Another 400 gender-matched healthy individuals were recruited to the current study as controls. Furthermore, the controls were unrelated healthy subjects from the same area who received annual examination in physical examination center of Northern Jiangsu People’s Hospital. They were collected randomly from the physical examination list. The control group included the following criteria:
(1) systolic blood pressure (SBP) of <130mmHg and diastolic blood pressure (DBP) of <85mmHg.
(2) no personal or family history of hypertension.
Hypertension in one or both biologic parents was considered to be a positive family history of EH. All subjects in the study were interviewed to identify both personal and family medical histories of clinical abnormalities. Verbal Informed Consent, medical history, clinical assessment and genetic analysis were obtained from each individual under protocols involved in the study. Verbal consent is that the mtDNA analysis is used only for diagnosis, not for treatment. It was of no harm to anyone. The protocol was implemented in accordance with the Declaration of Helsinki and approved by the ethics committee of the institutional review board at the Northern Jiangsu People’s Hospital.
Data collection
Body mass index (BMI) refers to a person’s body mass in kilograms divided by height in square meters (kg/m2). Patients reporting cigarette use within one year prior to examination were considered as smokers. Blood pressure was measured by an experienced physician who was blinded to the study according to the criteria of the World Health Organization (WHO) [13]. Three measurements of systolic and diastolic blood pressure were taken and the mean value was used as the measurement. According to the 2010 Chinese Hypertension Management, hypertension was diagnosed as follows [14]: the SBP > 140 mm Hg and/or DBP > 90 mm Hg measured three times on different days or a history of hypertension with current antihypertensive medications. All participants also underwent laboratory tests on hypertension risk factors. 12 hours after fasting, lipid profile, fasting blood glucose(FBG), and kidney function test were performed by an automatic biochemistry analyzer (Hitach 7600DDP, Japan).
Mitochondrial DNA analysis
Genomic DNA was extracted from each person’s peripheral blood using standard protocols [15]. MtDNA was isolated by Promega Wizard Genomic DNA Purification Kit (Madison, WI, USA). The main chromosome locations for hypertension as described previously [16] were screened using oligodeoxynucleotides 3777-4679bp. The mitochondrial tRNAIle gene was amplified by Polymerase chain reaction (PCR) using the primer sequences as follows: forward: 5′- TGGCTCCTTTAACCTCTCCA-3′ and reverse: 5′- AAGGATTATGGATGCGGTTG -3′. PCR cycle program was carried out in a 9700 Thermocycler (Perkin-Elmer Applied Biosystems, Norwalk, USA). Each fragment had been purified and sequenced by ABI 3730 Sequence Analysis software (Applied Biosystems, Inc., Foster City, CA, USA) using the BigDye Terminator v1.1 kit (ABI Company, Carlsbad, CA, USA), and subsequently SeqWeb program GAP(GCG) was analyzed and compared with the updated consensus Cambridge Sequence [17, 18]. Pathogenic variants were identified from the mitochondrial map (https://www.mitomap.org/MITOMAP.) [19].
Statistical analysis
Statistical analysis was performed using R and SPSS software (version 22.0; SPSS Inc., Chicago, IL, USA). Continuous variables were tested for normal distribution by Kolmogorov-Smirnov test and then expressed by mean ± standard deviation (SD). The relationship between potential continuous and discrete factors and MIEH were analyzed with Student’s t-test and Fisher’s exact t-test. A P-value ≤0.05 was considered to be statistically significant.