Animal experiments
Animal experiments were approved by institutional review committees and conducted in accordance with the regulations for the care and use of animals at Kyoto University and Nippon Medical School. We compared male littermates raised in the same cages, unless otherwise noted.
Generation and establishment of a line of Cdh2R714G, I715D knock-in mice
We designed a targeting vector that spans a 9.6 kb region of the mouse the Cdh2 gene to replace six bases in exon 13 from 6656AGGATC to GGGGAT. After electroporation of the linearized vector into C57BL/6 mouse-derived Bruce 4 embryonic stem cells and selection of neomycin-resistant clones, we verified homologous recombination by Southern blotting and PCR (5’ side probes; Fw- GATGCTGCTAACAGATGACTACAGA, Rv-AAAGGTACTGACAATAGGGCTCATA and 3’ side probes; Fw-TCTCAAAGACTCCTATTGCTGTTCT, Rv-GTGTCTATAAGCTCCCATCAATGTC) of the genomic DNA. After blastocyst injection of the recombinant clones, we obtained chimera mice, which were crossbred with transgenic mice that ubiquitously express Cre-recombinase (CAG-Cre, C57BL/6, RBRC01828). Through backcrossing with C57BL/6J mice for more than two generations, we verified the removal of the neomycin-resistant gene cassette and the CAG-Cre allele by Southern blotting and PCR, and Mendelian transmission of the Cdh2R714G, I715D allele. We bred heterozyzous Cdh2R714G, I715D/+ mice to generate homozygous (Cdh2R714G, I715D/R714G, I715D; GD) and control (Cdh2+/+; WT) littermates for experiments. The line has been deposited with the Center for Animal Resources and Development, Kumamoto University (ID 2027).
Genotyping
DNA from tail snips was purified using the automatic DNA isolation system PI-50(KURABO, Japan). Mouse Cdh2 gene were amplified using the following primers: Forward = CCA CTT CTA AGC ATG CAG GT; Reverse = AAT GAC TCC TAT TTG AGC ACA
Behavioral analyses
We conducted behavioral tests with male littermates during 3–5 months of age, using an established protocol [41]. The behavioral tests were conducted in the following order: general health and neurological screening (including body weight and temperature measurements, grip strength test, and righting, whisker touch, and ear twitch reflexes), wire hang test, Barnes maze test, eight-arm radial maze test, and fear conditioning test.
Eight-arm radial maze test
The protocol was as previously described [42]. We used an apparatus with a central platform connected to eight arms (40-cm long with 25-cm high transparent walls, food pellet wells and sensors at distal ends) with automated shutters, which was placed 75 cm above the floor in a dim room with several spatial cues. The animals were starved for over a week to induce 15-20% weight loss and started on pre-training on the eighth day. We allowed a mouse to explore and eat food pellets for 30 min. Then, we set a pellet in a well and let a mouse explore and eat it, which was repeated eight times, once for each arm. In the spatial working memory task, we set a pellet in each well, and observed until a mouse ate the eight pellets. After each visit to an arm, the shutters were closed for 5 s with mice at the center. We video-monitored and analyzed arm choices, latency to acquire eight pellets, distance traveled, the number of times empty arms were chosen in the first eight choices, and the number of revisiting errors. Image RM software was used for the control of shutters, data acquisition and analysis (see below for ‘IMAGE ANALYSIS’).
Contextual and cued fear conditioning test
To assess fear memory [43], mice were placed in a conditioning chamber (26×34×29 cm) in a sound attenuated room and allowed to explore freely for 2 min. The animals were presented with an auditory cue (55 dB white noise) which served as a conditioned stimulus (CS) for 30 sec. During the last 2 sec of the CS, mice were given a mild foot shock (2 sec, 0.35 mA) as an unconditioned stimulus (US). Two more CS-US pairings were presented with 120 sec interval. 24 hr later, context test was performed. Cued test in an altered context was performed using a triangular box (35×35×40 cm) made of white opaque plexiglas, located in a different room. Following initial 3-min of pre-CS period, the CS was presented for 3 min. Data acquisition, control of stimuli (white noise and foot shock), and data analysis were performed automatically using Image FZ software.
Image analysis
The application programs for behavioral data acquisition and analysis (Image BM, RM, FZ) were created on the platform of ImageJ (http://rsb.info.nih.gov/ij/) by TM.
Antibodies
We used commercial antibodies for the following antigens: N-cadherin (clone 32) and syntaxin-6 (clone 30, BD); β-actin, PSD95, and HA (Sigma); synaptophysin (clone SY38, Abcam); ADAM10 (AB19026), Presenillin1 (MAB5232), GluA1 (MAB2263), and GLT1 (MAB2262, Chemicon/Millipore); GluA2 (#13607), AKT (#9272), phospho-AKT (#9271), and α-Tubulin (#2144, CST); mouse and rabbit IgG, HRP-conjugated (NA931V and NA931934, GE Healthcare).
Plasmids
Ncad HA and NcadGD HA constructs, expressing the full-length human N-cadherin tagged with HA in C-terminus, as described elsewhere [20].
Primary mouse cortical neuron culture
Primary neurons from GD mice brain were obtained from the cerebral cortices of fetal mice (14-16 days of gestation). Obtained cells were maintained in Neurobasal medium (Gibco) containing GlutaMAX™-I(Gibco), B-27 supplement (Gibco) and 1% penicillin/streptomycin (Nacalai tesque).
Immunofluorescence
Chinese Hamster Ovary (CHO) cells were maintained in Dulbecco's Modified Eagle Medium/Nutrient Mixture DMEM/F-12 (Thermo scientific) containing 10% FBS (Invitrogen) and 1% penicillin/streptomycin (Nacalai tesque). For transient expression, Lepofectamin2000TM (Invitorogen), was used. After 24hrs, CHO were fixed, permeabilized and incubated in Block Aid (Thermo) for 1 hr. The primary antibodies against HA (1:1000) and β-catenin (1:1000) were incubated at 4 ℃ overnight. The secondary antibodies conjugated to Alexa-Fluor 488/546 were added for 1 h at room temperature. Cells were mounted onto slides by ProLong Gold antifade reagent with DAPI (Molecular Probes). Images were acquired using FLUOVIEW FV10i (OLYMPUS).
Internalization assay
CHO cells were transfected with Ncad-HA(WT) or Ncad GD-HA(GD mutant) and incubated with 1mg/ml Sulfo-NHS-LC-Biotin(Thermo) in KRPH Buffer(128mM NaCl, 4.7mM KCl, 1.25mM CaCl2, 1.25mM MgSO4, 5mM NaH2PO4, 20mM HEPES) at 4℃ for 1hr. Surface-biotinylated cells were washed in PBS and washed twice more with Biotin Blocking Reagent (50mM NH4Cl, 1mM MgCl2, 0.1mMCaCl2). Cells were replaced in DMEM/F12 containing 10% FBS and incubated at 37℃ for 1,3,6,12 hr. After incubation, cells were lysed in RIPA buffer (20mM Tris-HCl pH7.4, 150 mM NaCl, 0.1% SDS, 1% TritonX-100, 1% Sodium Deoxycholate, 5mM EDTA containing a protease inhibitor mix). Surface-biotinylated proteins were pulled down with streptavidin beads (Invitrogen), subjected to SDS PAGE and blotted with anti-HA-tag antibody (Sigma).
Preparation of synaptosome
Synaptosome was prepared according to the previous report of P.R. DODD et al [44]. In brief, mouse brain tissue was homogenized in 10 volumes of homogenization buffer (5 mM HEPES buffer, pH 7.4, containing 0.32 M sucrose, 50 mM sodium fluoride, with phosphatase and protease inhibitor cocktail) in a Potter–Elvehjem homogenizer. The homogenate was centrifuged at 1000 g at 4°C for 5 min, twice. Supernatant was layered directly onto 1ml 1.2 M sucrose and centrifuged at 50,000 rpm at 4℃ for 10 min. The Pellet of intermediate layer was collected and diluted with ice-cold 0.32 M sucrose to a final volume of 1 ml. The diluted suspension was then layered onto 0.8 ml of 0.8 M sucrose and centrifuged once again at 50,000 rpm at 4°C for 15 min. The pellet was suspended in RIPA buffer (with protease and phosphatase inhibitors. The pellet was then layered over discontinuous sucrose gradient (0.85–1.0–1.2 M) and centrifuged at 85,000g for 2h at 4°C. Synaptosomal fraction was obtained at the interface of 1 and 1.2 M sucrose.
Immunoblotting
Protein samples were prepared in 2x loading buffer (0.5 M Tris (pH 6.8), 10 % SDS, 12% 2-mercaptoethanol and 0.02% bromophenol blue), was separated to SDS– PAGE electrophoresis on a 5–20% precast-gels (ATTO Inc., Japan) and then transferred onto PVDF membranes. The membranes were blocked in 5% milk in TBS-T buffer (0.2M Tris(pH7.5), 1.37 M NaCl, 1% Tween) for 1h and then incubated with primary antibodies (1/1000) overnight. The secondary antibodies, anti-rabbit or anti-mouse IgG HRP conjugated (Cytiva) were then added for 1h at room temperature. The membranes were washed with TBS-T, and immunoreactive bands were visualized by Chemi-Lumi One L or supper (nacalai tesque, Japan).
Golgi Staining
Golgi staining was performed using a Rapid GolgiStain kit according to the manufacturer’s protocol (FD NeuroTechnologies, Columbia,MD). Mice were sacrificed at the age of 4 months. The brains were immersed in impregnation solution for 2 weeks in the dark, and then stored at 4℃ for a week. The brain samples were dipped into isopentane pre-cooled with dry ice, mounted with TFM (TBS,Durham,Nc,USA), sliced (80μm) with a cryostat ,and then mounted on gelatin-coated glass slides. Subsequently, the sections were stained with staining solution. Measurements of the spine area were made by Image J and Metamorph (Molecular Devices).
Serial section transmission electron microscopy (ssTEM)
The Electron microscopy procedure has been previously described [45]. Briefly, mice were fixed transcardially with 0.8% paraformaldehyde and 1.5% glutaraldehyde/0.1 M PB (pH 7.35). 70-µm sections were made with a Vibratome (VIB1500X, Leica). 50-nm ultrathin sections were cut with an ultramicrotome (Ultracut, Leica), mounted on grids and then observed with a TEM (JEM1010, JEOL).
Electrophysiology
Mice were decapitated under deep halothane anesthesia at the age of 14 to 15 weeks, and both hippocampi were isolated. Transverse hippocampal slices (380 μm) were cut using a tissue slicer and maintained in a humidified interface holding chamber. Electro-physiological recordings were performed as described [46]. Recordings were made in a submersion-type chamber maintained at 27.0 - 27.5 ºC and superfused at 2 ml/min with saline composed of (in mM): NaCl, 125; KCl, 2.5; NaH2PO4, 1.0; NaHCO3, 26.2; glucose, 11; CaCl2, 2.5; MgCl2, 1.3. For recording EPSPs arising from the A/C fiber-pyramidal cell synapses in the CA3 region, a glass recording pipette filled with 2 M NaCl and bipolar stimulating electrodes were placed in the stratum radiatum of the CA3 region. The initial slope of EPSPs was measured on analysis. Single electrical stimulation was delivered at a frequency of 0.05 Hz, unless otherwise specified. To induce LTP, high-frequency burst stimulation (5 pulse at 100 Hz, repeated 10 times at 5 Hz) was delivered 3 times at an interval of 20 s. For recording EPSPs at the Schaffer collateral/commissural synapses in the CA1 region, both recording and stimulating electrodes were placed in the stratum radiatum of the CA1 region, and the recording saline was supplemented with the GABAA receptor blocker picrotoxin (100 μM) and the NMDAR antagonist D-2-Amino-5-phosphonovaleric acid (D-APV, 100 μM). Picrotoxin was purchased from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan). D-APV was from Tocris Bioscience (Bristol, UK). All recordings were made using a Multiclamp 700B amplifier (Molecular Devices, Sunnyvale, CA, USA).
Statistical analysis
Quantitative data were expressed as mean ± SEM. For statistical analyses, either two tailed t-test or ANOVA (one-way, two-way repeated measures, and repeated measures with two factors) was applied using StatView (SAS institute). F and p values represent the effects of genotype, unless otherwise noted.
Results of behavioral analysis was summarized in Supplementary table 1. When we found significant difference in genotype and genotype x Trial/Delay/Time interaction (p<0.05), the data were processed with Dunn-Bonferroni post hoc test.