The identification and determination of toxin genes of Vibrio strains causing hemorrhagic disease on red drum (Sciaenops ocellatus) using PCR

doi:10.21203/rs.3.rs-64857/v5

Download PDF

Original article

The identification and determination of toxin genes of Vibrio strains causing hemorrhagic disease on red drum (Sciaenops ocellatus) using PCR

https://doi.org/10.21203/rs.3.rs-64857/v5

This work is licensed under a CC BY 4.0 License

Journal Publication

published 04 Jan, 2021

Read the published version in AMB Express →

You are reading this latest preprint version

Data were collected from 30 strains of Vibrio and sampled on different organs (brain, hemorrhagic site and digestive tract) of Sciaenops ocellatus infection. The results showed that the nucleotide sequences 16S rRNA region are highly similar to those of V. alginolyticus, V. azureus, V. fluvialis, V. natriengens and V. orientalis, which were published on Genbank and other, ranging from 98.05 to 100 %. The digestive tract has the most common Vibrio strains (V. alginolyticus [16] V. azureus [7] and V. fluvialis). Thereout, 25 of 30 strains of Vibrio contained 1 to 3 toxin genes, except V. parahaemolyticus. Six parameters were used to measure the DNA polymorphism of 33 homologous DNA sequences in this Vibrio bacteria population. The results indicated that number of separate polymorphic sites (S), total number of mutant sites (Eta), number of haplotype (h), haplotype diversity (Hd), average number of nucleotide differences (k), nucleotide diversity (Pi) were 98 (S), 103 (Eta), 9 (h), 0.887 ± 0.032 (Hd), 25.789 (k) and 17.980x10-3 ± 0.003 (Pi), respectively (P < 0,05). The G+C content above 1434 sites positions of nucleotide sequences accounted for 0.542. The phylogenetic tree showed that these strains are divided into six groups. As observed, the appearance of isolated Vibrio on 3 organs of fish (S. ocellatus) hemorrhagic are V. azureus (27,67 %), V. alginolyticus (50 %), V. orientalis (6,67 %) and V. fluvialis (16,67 %). Through this result, we found that the diversity of Vibrio species that appeared on the red drum was used in the 16S rRNA region and the presence of toxin genes in these Vibrio species.

Applied & Industrial Microbiology

Marine and Freshwater Biology

Sciaenops ocellatus

TDH

TRH

TLH

ToxR

Toxin gene

Vibrio

More than 100 Vibrio spp. have been reported and are predominantly associated with a variety of marine, estuarine, or other aquatic habitats (Janda, 2015). Red drum (Sciaenops ocellatus) was originally discovered in the Atlantic Ocean and the Gulf of Mexico; it was introduced into China in 1991, and since then, it has been cultured extensively in several provinces in China (Zhang & Sun, 2011). In recent years, red drum (S. ocellatus) mortalities have been associated with Streptococcus iniae infection (Eldar, Perl, Frelier, & Bercovier, 1999), (Mmanda et al., 2014). Seven Vibrio strains (including V. vulnificus HM-TA-D2-L2-V2; V. vulnificus HM-TA-G2-V1-D2; V. brasiliensis HM-X-13/6; V. cholerae V-13/6; V. parahaemolyticus HM-17/6; V. cholerae HM-V-13/6 and V. vulnificus HM-X-13/6) causing hemorrhagic disease in red drum (S. ocellatus) had only the tlh gene, and none of the Vibrio strains had tdh and trh genes (Hoang Tan Quang et al., 2020). The research identified this fish (S. ocellatus) viperin gene (SoVip) and analyzed its expression in relation to bacterial challenge. The complete SoVip gene is 2570 bp in length and contains six exons and five introns. The open reading frame of 1065 bp is flanked by a 50 untranslated region (UTR) of 34 bp and a 30 UTR of 350 bp and the fish pathogen Edwardsiella tarda but is downregulated by the fish pathogens Listonella anguillarum and Streptococcus iniae (Dang, Zhang, Hu, & Sun, 2010). Toxin gene neutrality was tested by three methods (Tajima’s D test - Methods for sequence analysis of candidate genes obtained; Fu and Li’s D* and F* test, Fu's Fs - statistic P values being significant or not), (Tajima, 1989), (Fu & Li, 1993) and (Fu, 1995), they indicated an excess of low frequency polymorphisms relating to expectation, evidence for a deficiency of alleles, as expected from a recent population bottleneck and the evolution of the studied 30 strains bacteria Vibrio, was balancing selection, sudden contraction, rare alleles appeared in populations with low frequency. The studied population had a few individuals showing large differences in comparison with other individuals. The study aims to identify and determine toxin genes in Vibrio infected red drum; hence, an understanding of Vibrio spp. infected on fish to cause Vibriosis in aquatic animals in brackish and marine water.

Collection of fish diseaseIn this study, data were collected from the field and stored at -20°C, and we used thirty strains of bacteria with different morphologies isolated from three different organs in fish (S. ocellatus) that have hemorrhagic disease (Fig 1) in Thua Thien Hue Province, Vietnam, based on medium TCBS (thiosulphate citrate bile salt sucrose).

Total DNA extraction method

The DNA extraction method presented in this paper is an improved method of phenol/chloroform extraction according to the method of (Neumann, Pospiech, & Schairer, 1992). We eliminated the step to use SDS/lysozyme or proteinase K and extraction of cells directly by phenol. To extract the DNA from bacteria isolated from hemorrhagic disease in fish, a 1 mL cell suspension was centrifuged at 8.000 rpm for 2 minutes for the collection of pellet cells. After removing the supernatant, the cells were washed with 400 µl STE buffer (100 mM NaCl, 10 mM Tris/HCl, 1 mM EDTA, pH 8.0) twice and then centrifuged at 8000 rpm for 2 minutes. The pellets were resuspended in 200 µl TE buffer (10 mM Tris/HCl, 1 mM EDTA, pH 8.0). After this, 100 µl Tris-saturated phenol (pH 8.0) was added to these tubes, followed by a vortex-mixing step of 60 s. The samples were subsequently centrifuged at 13.000 rpm for 5 minutes at 4°C to separate the aqueous phase from the organic phase. A total of 160 µl of the upper aqueous phase was transferred to a clean 1.5 ml tube. Forty microliters of TE buffer was added to 200 µl, mixed with 100 µl of chloroform and centrifuged for 5 minutes at 13,000 rpm at 4°C. The lysate was purified by chloroform extraction until a white interface was no longer present; this procedure might have to be repeated two to three times. A total of 160 µl of the upper aqueous phase was transferred to a clean 1.5 ml tube. Then, 40 µl TE and 5 µl RNase (at 10 mg/ml) were added and incubated at 37°C for 10 minutes to digest RNA. Then, 100 µl chloroform was added to the tube, mixed well and centrifuged for 5 minutes at 13.000 rpm at 4 °C. Then, 150 µl of the upper aqueous phase was transferred to a clean 1.5 ml tube. The aqueous phase contained purified DNA and was directly used for the subsequent experiments or stored at 20°C. The purity and yield of the DNA were assessed spectrophotometrically by calculating the A₂₆₀/A₂₈₀ ratios and the A₂₆₀ values to determine protein impurities and DNA concentrations according to (Neumann et al., 1992).

Determination of toxin gene

The presence of toxin genes in Vibrio spp. strains was determined through the presence of genes encoding toxic proteins (tlh, tdh, trh and toxR), which are based on specific primers for these genes (Table 1). PCR procedure: 50 ng of total DNA, 10 pmol of each primer, 25 µl PCR master mix 2 × (2.4 mM dNTPs each, 0.3 units Taq DNA polymerase, Promega, USA), and sterile distilled water (total volume of 50 µL). PCR amplification was performed in an MJ Mini^TM Thermal Cycler (Bio-Rad, USA) as follows: 94 °C for 3 minutes; followed by 30 cycles at 94 °C for 1 minute, 50 °C for 1 minute, and 72 °C for 1 minute; and a final cycle of 72 °C for 7 minutes. PCR products were used for electrophoresis on a 1% agarose gel using standard electrophoresis procedures in TAE 1X buffer with ethidium bromide dye, and electrophoresis images were read by a direct UV reading system (UV-transilluminator, Model: DyNa Light).

16S rRNA Gene Amplification and Sequencing

PCR was performed to amplify the 16S rRNA region originating from the genome with a pair of 16S primers: 27F: AGAGTTTGATCMTGGCTCAG and 1492R: TACGGYTACCTTGTTACGACTT (Jeremy A Frank et al., 2008). PCR was performed on Applied Biosystems – Life Technologies – Thermo Fisher Scientific – USA with a reaction component of 25 µl PCR master mix 2 × (2.4 mM dNTPs each, 0.3 units Taq DNA polymerase), 10 pmol of 27F primer, 10 pmol of 1492 primer, 1 µl of total DNA (50 ng/µl) and sterile distilled water to a final volume of 50 µl. The 16S rRNA gene region was amplified with the following thermal cycle: 95°C/5 minutes; 30 cycles x (95°C/60 seconds; 57°C/50 seconds; 72°C/60 seconds); 72°C/10 minutes. Aliquots (10 µl) of PCR products were electrophoresed and visualized in 1% agarose gels using standard electrophoresis procedures in TAE 1X buffer with ethidium bromide dye, and electrophoresis images were read by a direct UV reading system (UV transilluminator, Model: DyNa Light). Partial 16S rRNA genes of selected isolates in each site were sequenced by MACROGEN, Republic of Korea (dna.macrogen.com). Finally, the 16S rRNA sequence of the isolation was compared with that of other microorganisms using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi).

Table 1 Sequence of primers

Genes	Primer names	Nucleotide sequences 5’→3’	Size (bp)	References
toxR	toxR-F	GTCTTCTGACGCAATCGTTG	367	Luan et al., 2007; Marlina et al., 2007
	toxR-R	ATACGAGTGGTTGCTGTCATG
Tdh	tdh-F	GTAAAGGTCTCTGACTTTTGGAC	500	Luan et al., 2007; Marlina et al., 2007
	tdh-R	TGGAATAGAACCTTCATCTTCACC
Trh	trh-F	TTGGCTTCGATATTTTCAGTATCT	269	Luan et al., 2007; Marlina et al., 2007
	trh-R	CATAACAAACATATGCCCATTTCC
Tlh	tlh-F	AAAGCGGATTATGCAGAAGCACTG	450	Luan et al., 2007; Marlina et al., 2007
	tlh-R	GCTACTTTCTAGCATTTTCTCTGC

tdh=Thermostable direct hemolysin, trh=TDH-related hemolysin, tlh=Thermolabile hemolysin, toxR=Toxin operon (Luan et al., 2007), (Marlina et al., 2007).

Sequencing and analyzing genetic relationships

The PCR products of the 16S rRNA region were purified with Isolate II PCR and Gel (Bioline) kits. Then, they were sequenced directly by the dideoxy termination method on the ABI PRISM^® 3100 Avant Genetic Analyzer (Applied Biosystems) at Maccrogen Company, Korea (dna.macrogen.com). The nucleotide sequences were arranged based on the Clustals program (Thompson, Gibson, Plewniak, Jeanmougin, & Higgins, 1997) and edited by using BioEdit 7.0.5 software (Hall, 1999). Finally, the 16S rRNA sequence of the isolation was compared with that of other microorganisms using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi). The DNA polymorphism analysis was based on eight parameters, including the number of separate polymorphic sites (S), total number of mutant sites (Eta), number of haplotypes (h), haplotype diversity (Hd), average number of nucleotide differences (k), and nucleotide diversity (Pi), considered polymorphic measurements in the population (J. Rozas & R. Rozas, 2005). Neutrality was tested based on three methods, Tajima’s D test (Tajima, 1989), Fu and Li’s D * and F* test (Fu & Li, 1993) and Fu's (Fu, 1995), using DNASP 6.0 software. A phylogenetic tree showing genetic relationships was built by MEGA X software (Molecular Evolution Genetics Analysis) based on the UPGMA method (Sneath & Sokal, 1973). The optimal tree with the sum of branch length equal to 0.08795656 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches (J, 1985). The tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the maximum composite likelihood method (Koichiro Tamura, Masatoshi Nei, & Kumar, 2004) and are in units of the number of base substitutions per site. This analysis involved 48 nucleotide sequences. All ambiguous positions were removed for each sequence pair (pairwise deletion option). There were a total of 1434 positions in the final dataset. Evolutionary analyses were conducted in MEGA X (Kumar S., Stecher G., Li M., Knyaz C., & K., 2018).

PCR result

The PCR products of the 16S rRNA region were purified with Isolate II PCR and Gel (Bioline) kits. Then, they were sequenced directly by the dideoxy terminator method on the ABI PRISM^® 3100 Avant Genetic Analyzer (Applied Biosystems) at Maccrogen Company, Korea (dna.macrogen.com). The 16S rRNA region was approximately 1450 bp for the remaining 30 isolated bacterial strains based on TCBS medium. The BLAST result on NCBI was used to verify and compare with the sequences of the Vibrio spp. with accession number GenBank (Table 2) showed that the nucleotide sequences obtained were highly similar to those of V. alginolyticus, V. azureus, V. fluvialis and V. orientalis, ranging from 98,05 to 100% (Table 2).

The results indicated that all PCR products of the 16S rRNA region in the 30 isolated bacterial strains based on medium TCBS showed a single band with a 100% amplification rate. All samples gave high DNA concentrations and are clearly seen. The obtained size was approximately 1.500 bp, which is in line with the initial expected size (Fig. 2)

Determination of toxin gene

The agarose gel electrophoresis of PCR products determined the presence of the trh, tdh, tlh and toxR genes at bands 269 bp, 500 bp, 450 bp and 367 bp, respectively (Fig. 2). We found that 25/30 strains of Vibrio contained at least 1 toxic gene, whereas 5 isolates carried 3 toxin genes. However, none of these isolates consisted of all virulence toxin genes (Table 2). The results clearly indicated the presence of virulence toxins (trh, tdh and tlh) and a regulator toxin (toxR). Among them, 18 isolates presented tlh, while only 2 isolates were found to carry tdh gen.

Sequencing and analyzing genetic relationships

Table 2 Phylogenetic affiliation of isolates on the basis of 16S rRNA gene sequences by using the BLAST program in the GenBank database based on sequence similarity and determination of toxin genes

No	Isolated	Genbank code	GenBank reference	Similarity (%)	Genes
No	Isolated	Genbank code	GenBank reference	Similarity (%)	*toxR*	*tdh*	*trh*	*Tlh*
1	Vibrio alginolyticus strain YHTH7	MT953948	MN874162.1	98.06	-	-	+	-
2	Vibrio azureus strain YVL11	MT953949	KT986135.1	100	-	-	-	-
3	Vibrio azureus strain HTH12	MT953950	KT986135.1	100	-	-	-	-
4	Vibrio alginolyticus strain YN14	MT953951	MH298564.1	98.05	+	-	-	+
5	Vibrio fluvialis strain YHTH16	MT953952	CP051126.1	100	+	-	-	+
6	Vibrio alginolyticus strain YVL22	MT953953	MN843961.1	99.72	+	-	+	+
7	Vibrio alginolyticus strain YVL24	MT953954	MN938185.1	99.86	+	+	-	+
8	Vibrio alginolyticus strain YVL26	MT953955	CP051109.1	99.59	-	-	-	-
9	Vibrio orientalis strain YVL27	MT953956	MN945276.1	100	-	-	-	+
10	Vibrio alginolyticus strain YN34	MT953957	MN938360.1	99.65	-	-	+	+
11	Vibrio azureus strain YVL5	MT953958	KT986135.1	100	-	-	+	-
12	Vibrio azureus strain HTH6	MT953959	KT986135.1	100	+	-	-	+
13	Vibrio fluvialis strain YHTH18	MT953960	CP051126.1	100	+	-	+	-
14	Vibrio alginolyticus strain YN19	MT953961	MH298564.1	98.05	+	-	-	+
15	Vibrio alginolyticus strain YN29	MT953962	MN843961.1	99.72	-	-	-	+
16	Vibrio alginolyticus strain YVL31	MT953963	MN938185.1	99.86	-	-	+	+
17	Vibrio alginolyticus strain YVL40	MT953964	CP051109.1	99.59	+	-	-	+
18	Vibrio alginolyticus strain YVL43	MT953965	MN938360.1	99.65	+	-	-	-
19	Vibrio orientalis strain YVL42	MT953966	MN945276.1	100	+	-	+	+
20	Vibrio alginolyticus strain YHTH44	MT953967	MN874162.1	98.06	+	-	+	+
21	Vibrio azureus strain YVL45	MT953968	KT986135.1	100	+	-	-	+
22	Vibrio azureus strain YVL46	MT953969	KT986135.1	100	-	-	+	-
23	Vibrio fluvialis strain YHTH47	MT953970	CP051126.1	100	-	-	-	-
24	Vibrio azureus strain YVL33	MT953971	KT986135.1	100	+	+	-	-
25	Vibrio azureus strain YHTH35	MT953972	KT986135.1	100	-	-	-	+
26	Vibrio fluvialis strain YHTH37	MT953973	CP051126.1	100	-	-	-	+
27	Vibrio alginolyticus strain YN38	MT953974	MH298564.1	98.05	+	-	-	+
28	Vibrio alginolyticus strain YVL84	MT953975	MN843961.1	99.72	-	-	-	-
29	Vibrio alginolyticus strain YVL85	MT953976	MN938185.1	99.86	-	-	-	+
30	Vibrio alginolyticus strain YVL86	MT953977	CP051109.1	99.59	+	-	-	-

tdh=Thermostable direct hemolysin, trh=TDH-related hemolysin, tlh=Thermolabile hemolysin, toxR=Toxin operon

GenBank registration Code No: MT953948[ACCN]: MT953977[ACCN]; https://submit.ncbi.nlm.nih.gov/subs/?search=SUB8088865

Table 3 DNA diversity based on the 16S rRNA region of the bacterial Vibrio population using the DNASp 5.0 program (J. Rozas & R. Rozas, 2005)

Genetic region

Eta

G+C content

(1434 sites)

(x10⁻³)

16S rRNA

103

0.542

0.887 ± 0.032

25.789

17.980 ± 0.003

Number of variable sites (S); Total number of mutations (Eta); Number of haplotypes (H); haplotype (gene) diversity (Hd); nucleotide diversity (per site) (Pi); average number of nucleotide differences (k)

Six parameters, including the number of polymorphic sites (S), total number of mutant sites (Eta), number of haplotypes (h), haplotype diversity (Hd), average number of nucleotide differences (k), and nucleotide diversity (Pi), were used to evaluate the diversity of the 30 studied Vibrio strains. As shown in Table 4, ninety-eight separate polymorphic positions (S) created 103 mutant positions (Eta) shown in 30 studied bacterial strains. Vibrio were classified into nine types of haplotypes (h) with a haplotype diversity coefficient accounting for 0.887 ± 0.032 (Hd), an average number of nucleotide differences of 25.789 (k), and a nucleotide diversity coefficient of 17.980x10^-3 ± 0.003 (Pi). All indicators were processed with statistical significance p <0,05. The G+C content above 1434 site positions of nucleotide sequences accounted for 0.542 (Table 3). Three methods, namely, Tajima’s D test, Fu and Li’s D* and F* test, and Fu's Fs, were used to test neutrality.

Table 4 Neutrality test results based on the 16S rRNA region of the bacterial Vibrio population

Genetic region	Tajima’s D test	*Fu and Li’s D test**	Fu and Li’s F* test*	Fu's Fs
16S rRNA	-0.03099	1.91401	1.49643	13.659
16S rRNA	Statistical significance: Not significant, P > 0.10	Statistical significance: , P < 0.02	Statistical significance: Not significant, 0.10 > P > 0.05	Strobeck's S statistic: 0.000

The results in Table 4 indicated that a negative Tajima’s D signifies an excess of low-frequency polymorphisms compared with the initial expectation (statistical significance: not significant, p>0.10). Meanwhile, a positive value of F_S (13.659) is evidence for a deficiency of alleles, as would be expected from a recent population bottleneck (Strobeck's S statistic: 0.000). In addition, Fu and Li's F * (statistical significance 0.10 > p > 0.05) and the value of Fu and Li's D* (statistical significance: **, P < 0.02) both yielded positive results, which showed that the evolution of the 30 studied bacterial strains in the Vibrio population was balancing selection and sudden contraction; in other words, rare alleles appeared in populations with low frequency, and the studied population had very few individuals showing large differences in comparison with other individuals in the population (Table 4). The phylogenetic tree shows the genetic relationship of thirty Vibrio strains isolated from three different parts of the fish (S. ocellatus) using the UPGMA method. Fig. 3, these strains are divided into six groups. Among these, group I includes the strains of isolated Vibrio that are closely related to V. azureus. These strains are mainly concentrated in the digestive system and are hemorrhagic. Groups II, III and V consist of Vibrio strains isolated in 3 different parts (brain, hemorrhagic and digestive system). They are closely related to V. alginolyticus. Group 4 includes two strains isolated from the ulcer that are closely related to Vibrio orientalis. Group VI consists of 4 strains, concentrated in the digestive system and having a close genetic relationship with V. fluvialis (Fig. 3). As observed, the isolated Vibrio on 3 organs of red drum fish showing signs of hemorrhagic bleeding were V. azureus (27,67 %), V. alginolyticus (50 %), V. orientalis (6,67 %) and V. fluvialis (16,67 %).

In this study, we isolated 30 strains of Vibrio from three different organs (brain, hemorrhagic site and digestive tract) of S. ocellatus. The results showed that the nucleotide sequence 16S rRNA regions are highly similar to those of V. alginolyticus, V. azureus, V. fluvialis and V. orientalis published in GenBank, ranging from 98.05 to 100%. The digestive system has the most common Vibrio species (V. alginolyticus, V. azureus). None of the V. parahaemolyticus species were present in the samples, and the same report identified that Vibrio species were isolated from cultured olive flounder (Paralichthys olivaceus) on Jeju Island, South Korea, and none of the V. parahaemolyticus species were also present (Sohn, Kim, Jin, & Lee, 2019), as reported by (Hoang Tan Quang et al., 2020). The V. parahaemolyticus strain is a pathogen causing shrimp disease, (Dao, Linh, & Khanh, 2014), (Khanh et al., 2019).

The presence of toxic genes related to the hemolysin of fish was found in various Vibrio sp. Meanwhile, approximately 50% of isolates consisted of toxin operon genes. All V. parahaemolyticus isolates contained the toxR genes, but the trh gene did not exist in clams (Corbicula moltkiana) (Marlina et al., 2007). Our data confirmed that three isolates carried both toxR and trh genes, including isolates that exhibited high similarity to V. fluvialis, V. alginolyticus, and V. orientalis. TDH is an enzyme that lyses human red blood cells on Wagatsuma blood agar plates, which is referred to as the Kanagawa phenomenon positive. Another toxin produced by Kanagawa phenomenon-negative Vibrio strains is the tdh-related hemolysin (trh) toxin encoded by the trh gene (Al-Othrubi, Alfizah, Son, Humin, & Rahaman, 2011). Thermolabile hemolysin (tlh) is another Vibrio enterotoxin that causes blood cell lysis in infected fish, and tlh is encoded by the tlh gene (Hasrimi, Budiharjo, & Jannah, 2018). Among the 4 toxin genes (toxR, tdh, trh and tlh) investigated from Vibrio spp. causing hemorrhagic disease in S. ocellatus, the results showed that the frequency of the toxR gene was detected in the 15 isolates using PCR assay, lowest of tdh gene was 2 isolates, trh gene was 9 isolates and the highest of tlh was 18 isolates using PCR assay. In addition, the frequency of toxin gene occurrence also showed that there were 5/30 Vibrio strains none carrying the toxin gene (code number: YHTH12; YHTH47; YVL11; YVL26 and YVL84), 10/30 strains carrying only 1 toxin gene, 11/30 strains carrying 2 toxin genes and 4 strains carrying 3 toxin genes (V. alginolyticus strain 3-31, code number YHTH44 (toxR, trh and tlh); V. alginolyticus strain 3- 31, code number YVL22 (toxR, trh and tlh); V. alginolyticus strain 3-5, code number YVL24 (toxR, tdh and tlh) and V. orientalis strain 5-13, code number YVL42 (toxR, trh and tlh)). None of Vibrio carried all 4 toxin genes, . All Vibrio strains isolated from three marine fish species (S. ocellatus, Lates calcarifer and Epinephelus fuscoguttatus) carried only one tlh gene (Hoang Tan Quang et al., 2020). According to Long et al, 2019, we isolated and identified the V. parahaemolyticus 01 strain in Thua Thien Hue Province, Vietnam, causing ulcer disease in S. ocellatus. The full-length thermolabile hemolysin (tlh) gene (1257 bp), encoding the antigen thermolabile hemolysin toxin (tlh) of Vibrio sp. was cloned and sequenced successfully. Sequence analysis of cloned genes showed complete similarity to the V. parahaemolyticus strain (GenBank: AY289609.1) (Long et al., 2019). We further examined the presence of virulence genes homologous to those in V. cholerae (toxR, toxS, VPI and ace); toxR was found in 16 V. alginolyticus strains, and toxS was found in 17 strains out of 34. Indicated in two species (Dicentrarchus labrax) and (Sparus aurata). Positive amplification of the virulence pathogenicity island (VPI) was produced by 12 V. alginolyticus strains. Finally, the expected amplification fragment was found in 7 V. alginolyticus isolates. Thus, the pathogenicity of V. alginolyticus may be the result of a combination of all these factors (Kahla-Nakbi, Chaieb, & Bakhrouf, 2009).

Six parameters were used to evaluate the diversity of the 30 studied Vibrio bacterial strains. The results showed that ninety-eight separate polymorphic positions (S) created 103 mutant positions (Eta) shown in 30 studied Vibrio strains classified into nine types of haplotypes (h) with a haplotype diversity coefficient accounting for 0.887±0.032 (Hd), an average number of nucleotide differences of 25.789 (k), and a nucleotide diversity coefficient of 17.980x10^-3±0.003 (Pi). All indicators were processed with statistical significance p < 0.05. The G+C content above 1434 site positions of nucleotide sequences accounted for 0.542. Neutrality was tested based on three methods (Tajima’s D test, Fu and Li’s D* and F* test, Fu's Fs) showing that there was an excess of low frequency polymorphisms relative to expectation, evidence for a deficiency of alleles, as would be expected from a recent population bottleneck and the evolution of the studied 30 Vibrio bacteria population was balancing selection, sudden contraction or in other words, rare alleles appeared in populations with low frequency, the studied population had very few individuals showing large differences in comparison with other individuals in the population. The phylogenetic tree showed the genetic relationship of 30 Vibrio strains using the UPGMA method (bootstrap = 1000) and showed that these strains were divided into six groups. As observed, the isolated Vibrio on 3 hemorrhagic organs of fish (S. ocellatus) were V. azureus (27,67 %), V. alginolyticus (50 %), V. orientalis (6,67 %) and V. fluvialis (16,67 %).

PCR: Polymerase chain reaction; TCBS: Thiosulphate citrate bile salt sucrose; tlh: Thermolabile hemolysin toxin; trh: tdh-related hemolysin; tdh: Thermostable direct hemolysin; toxR: Toxin operon

Ethics approval and consent to participate

Samples and animals in this study, were allowed by local authorities of Thua Thien Hue province’s department of Fisheries. The research proposal was approved by Hue University’s Scientific and Training Committee.

Consent for application

Not applicable

Availability of data and materials

All the data were presented in the main paper

Competing interests

The authors declare that they have no competing interests

Author’s contributions

Pham Thi Hai Yen collected samples, isolated the bacterial strains, performed PCR method, DNA extraction and wrote the manuscript. Nguyen Duy Quynh Tram collected samples, analyzed the data and Nguyen Quang Linh analyzed the data, supervised and wrote the manuscript. All authors read and approved the final manuscript.

Funding

The paper was supported financially partly by Hue University and Vietnam Ministry of Education and Training (project code: CT-2018-DHH-07) for submission.

Acknowledgement

This study was made possible with the technical assistance of Mr. Dang Thanh Long in laboratories who worked at Institute of Biotechnology, Hue University, Vietnam.

Authors' information

¹University of Agriculture and Forestry, Hue University, Hue, 530000, Vietnam. ²Institute of Biotechnology, Hue University, Hue, 530000, Vietnam.

Al-Othrubi, S. M., Alfizah, H., Son, R., Humin, N., & Rahaman, J. (2011). Rapid detection and E-test antimicrobial susceptibility testing of Vibrio parahaemolyticus isolated from seafood and environmental sources in Malaysia. Saudi Med. J, 32, 400-406. doi:https://pubmed.ncbi.nlm.nih.gov/21484001/

Dang, W., Zhang, M., Hu, Y.-h., & Sun, L. (2010). Differential regulation of Sciaenops ocellatus viperin expression by intracellular and extracellular bacterial pathogens. Fish & shellfish immunology, 29(2), 264-270. doi:https://doi.org/10.1016/j.fsi.2010.04.015

Dao, N. T. B., Linh, N. Q., & Khanh, N. (2014). Research on some characteristics of Vibrio parahaemolyticus which causes EMS disease on juvenile shrimp at Dien Huong community, Phong Dien district, Thua Thien Hue, Vietnam. Hue University of journal of Science, 13-22.

Eldar, A., Perl, S., Frelier, P., & Bercovier, H. (1999). Red drum Sciaenops ocellatus mortalities associated with Streptococcus iniae infection. Diseases of aquatic organisms, 36(2), 121-127. doi:http://dx.doi.org/10.3354/dao036121

Fu, Y.-X. (1995). Statistical properties of segregating sites. Theoretical population biology, 48(2), 172-197. doi:https://doi.org/10.1006/tpbi.1995.1025

Fu, Y.-X., & Li, W.-H. (1993). Statistical tests of neutrality of mutations. Genetics, 133(3), 693-709. doi:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1205353/pdf/ge1333693.pdf

Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Paper presented at the Nucleic acids symposium series. https://www.academia.edu/2034992/BioEdit_a_user-friendly_biological_sequence_alignment_editor_and_analysis_program_for_Windows_95_98_NT

Hasrimi, A. N., Budiharjo, A., & Jannah, S. N. (2018). Detection of tlh and tdh genes in Vibrio parahaemolyticus inhabiting farmed water ecosystem used for L. Vannamei aquaculture. Journal of Physics: Conference Series, 1025, 1-9. doi:https://doi.org/10.1088/1742-6596/1025/1/012058

Hoang Tan Quang, Tran Thuy Lan, Truong Thi Hong Hai, Pham Thi Hai Yen, Tran Quang Khanh Van, Ho Thi Tung, . . . Tram, N. D. Q. (2020). Genetic diversity and toxic genes analysis of Vibrio spp. isolated from white leg shrimp and marine fishes cultured in Tam Giang lagoon in Thua Thien Hue province, Vietnam. INDIAN JOURNAL OF SCIENCE AND TECHNOLOGY, 13(13), 1412–1422. doi:https://doi.org/10.17485/IJST/v13i13.161

J, F. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution, 39, 783-791. doi: https://doi.org/10.1111/j.1558-5646.1985.tb00420.x

Rozas, & R. Rozas. (2005). DnaSP version 4.1: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics, 15, 174-175. doi:https://doi.org/10.1093/bioinformatics/15.2.174

Janda, J. M., Newton, A. E., & Bopp, C. A. (2015). Vibriosis. Clinics in laboratory medicine, 35(2), 273-288.

Jeremy A Frank, Claudia I Reich, Shobha Sharma, Jon S Weisbaum, renda A Wilson, & Olsen, G. J. (2008). Critical Evaluation of Two Primers Commonly Used for Amplification of Bacterial 16S rRNA Genes. Applied and Environmental Microbiology, 74(8), 2461-2470. doi:http://doi.org/10.1128/AEM.02272-07

Kahla-Nakbi, A. B., Chaieb, K., & Bakhrouf, A. (2009). Investigation of several virulence properties among Vibrio alginolyticus strains isolated from diseased cultured fish in Tunisia. Diseases of aquatic organisms, 86(1), 21-28. doi: https://doi.org/10.3354/dao02091

Khanh, N. V., Linh, N. n. Q., Lan, T. n. T. y., Vân, T. n. Q. K. n., Cơ, N. n. T. K., & Dung, T. n. Q. c. (2019). Isolation and screening of Vibrio parahaemolyticus strains to cause acute hepatopancreatic necrosis disease in white-leg shrimps cultured in Phong Dien, Thua Thien Hue, Vietnam using 16S rRNA marker. Hue University Journal of Science: Natural Science, 128(1E), 47-58. doi: http://dx.doi.org/10.26459/hueuni-jns.v128i1E.5443

Koichiro Tamura, Masatoshi Nei, & Kumar, S. (2004). Prospects for Inferring Very Large Phylogenies by Using the Neighbor-Joining Method. Proc Natl Acad Sci U S A, 101(30), 11030–11035. doi:https://doi.org/10.1073/pnas.0404206101

Kumar S., Stecher G., Li M., Knyaz C., & K., T. (2018). MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. . Molecular Biology and Evolution, 35, 1547-1549. doi:https://doi.org/10.1093/molbev/msy096

Long, D. T., Hoang, N. T., Hong, H. T. K., Yen, P. T. H., Chuong, H. V., Trang, N. T. Q., & Hiep, N. V. (2019). Isolation and DNA cloning of thermolabile hemolysin gene of Vibrio bacteria from Sciaenops ocellatus in Thua Thien Hue, Vietnam. Hue University Journal of Science: Natural Science, 128(1E), 5-14. doi:http://dx.doi.org/10.26459/hueuni-jns.v128i1E.5373

Luan, X. Y., Chen, J. X., Zhang, X. H., Jia, J. T., Sun, F. R., & Li, Y. (2007). Comparison of different primers for rapid detection of Vibrio parahaemolyticus using the polymerase chain reaction. Letters in applied microbiology, 44(3), 242-247. doi: https://doi.org/10.1111/j.1472-765X.2006.02074.x

Marlina, R. S., Kqueen, C. Y., Napis, S., Zakaria, Z., Mutalib, S. A., & Nishibuchi, M. (2007). Detection of tdh and trh genes in Vibrio parahaemolyticus isolated from Corbicula moltkiana prime in West Sumatera, Indonesia. Southeast Asian J Trop Med Public Health, 38, 349-355. doi:https://pubmed.ncbi.nlm.nih.gov/17539286/

Mmanda, F. P., Zhou, S., Zhang, J., Zheng, X., An, S., & Wang, G. (2014). Massive mortality associated with Streptococcus iniae infection in cage-cultured red drum (Sciaenops ocellatus) in Eastern China. African Journal of Microbiology Research, 8(16), 1722-1729. doi:https://doi.org/10.5897/AJMR2014.6659

Neumann, B. r., Pospiech, A., & Schairer, H. U. (1992). Rapid isolation of genomic DNA from gram-negative bacteria. Trends in genetics: TIG, 8(10), 332-333. doi:https://doi.org/10.1016/0168-9525(92)90269-A

Sneath, P., & Sokal, R. (1973). Numerical Taxonomy. The principle and practice of numberical classification. WH Freeman and Co. San Francisco, 263-268. doi:https://www.jstor.org/stable/2412767?seq=1

Sohn, H., Kim, J., Jin, C., & Lee, J. (2019). Identification of Vibrio species isolated from cultured olive flounder (Paralichthys olivaceus) in Jeju Island, South Korea. Fisheries and Aquatic Sciences, 22(1), 14. doi:https://doi.org/10.1186/s41240-019-0129-0

Tajima, F. (1989). Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123(3), 585-595. doi:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1203831/pdf/ge1233585.pdf

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., & Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic acids research, 25(24), 4876-4882. doi:https://doi.org/10.1093/nar/25.24.4876

Zhang, M., & Sun, L. (2011). The tissue factor pathway inhibitor 1 of Sciaenops ocellatus possesses antimicrobial activity and is involved in the immune response against bacterial infection. Developmental & Comparative Immunology, 35(3), 247-252. doi:https://doi.org/10.1016/j.dci.2010.10.006

Download PDF

Journal Publication

published 04 Jan, 2021

Read the published version in AMB Express →

Editor assigned by journal
03 Dec, 2020
Editorial decision: Accept
03 Dec, 2020
Submission checks completed at journal
03 Dec, 2020
Editor invited by journal
03 Dec, 2020

You are reading this latest preprint version

The identification and determination of toxin genes of Vibrio strains causing hemorrhagic disease on red drum (Sciaenops ocellatus) using PCR

Status:

Journal Publication

Version 5

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

List Of Abbreviations

Declarations

References

Status:

Journal Publication

Version 5