Animals
C57BL/6J mice were purchased from Jackson Laboratories. C57BLKS-Leprdb homozygote males and C57BLKS-Dock7m homozygote males were purchased from Jackson Laboratories. LRG1-KO (Lrg1-/-) line was generated in C57BL/6J background by the CRISPR and Gene Editing Center at the Rockefeller University and backcrossed with C57BL/6J mice for at least five generations to minimize off-target effects. Cohorts of LRG1-KO and WT littermates for characterization studies were obtained by intercrossing male and female heterozygotes. Animals were maintained at the Rockefeller University Comparative Biosciences Center, housed at 23ºC and maintained at 12 h light:dark cycles. The animals were group-housed with ad libitum access to food and water except during metabolic characterization studies. C57BL/6J mice were fed standard chow diet (LabDiet 5053), and where specified, started on 60% high fat diet (HFD, Research Diets D12492) feeding at 6 or 8 weeks of age. C57BLKS-Leprdb and C57BLKS-Dock7m were fed standard chow diet. Virus injections were performed in designated ABSL-2 housing rooms and the transduced mice were quarantined for 72 hours post-injection before transferred to regular housing rooms. Experiments involving adenoviral and AAV8 vectors were performed in accordance with the institutional ABSL-2 guidelines. All animal studies were performed in accordance with the institutional guidelines of the Rockefeller University Institutional Animal Care and Use Committee (IACUC).
Metabolic characterization of mice
For studies involving diet-induced obesity, mouse body weights were monitored once a week, providing fresh 60% high fat diet (Research Diets) at least once a week. For fasting blood glucose measurements, mice were single housed in the morning in cages with fresh bedding and access to water but without food. Mice were kept in a procedure room free of noise or vibration throughout the experiment. After 6 h, blood was collected from the tail vein, and glucose levels were measured using a glucose meter. For plasma insulin ELISA, blood was also collected in EDTA-coated capillary tubes, which were centrifuged at 2000×g for 15 min at 4ºC to collect plasma. Insulin ELISA was performed using Ultra Sensitive Mouse Insulin ELISA Kit (Crystal Chem). Glucose (GTT) and insulin tolerance tests (ITT) were performed following a similar 6 h fasting procedure and started by intraperitoneally injecting at time 0 indicated doses of glucose or Novolin R human insulin (Novo Nordisk). Following injection, blood glucose measurements were taken from the tail vein at indicated timepoints. During an ITT procedure, mice with glucose measurements below 20 mg/dL or showing signs of hypoglycemia were rescued by 1 g/kg glucose IP injection and excluded from the study.
Generation of LRG1-KO mice
CRISPR guide RNAs were designed using CRISPOR.org (Concordet and Haeussler, 2018) and were used as two-part synthetic crRNA and tracrRNA (Alt-RTM CRISPR guide RNA, Integrated DNA Technologies, Inc). Cas9 protein, crRNA, and tracrRNA were assembled to ctRNP using protocols described previously (Shola et al., 2021). Two crRNAs were assembled to ctRNPs and electroporated to one-cell-stage mouse embryos to assess their efficiency in generating indels on the Exon 2 of Lrg1 gene. To prepare for the microinjection mix, crRNA-B which binds to genomic target sequence “AATCTCGGTGGGACCATGGCAGG” was selected for its high on-target efficiency and low off-target potential. The final injection mix was made of 0.6 µM of guide RNA (crRNA + tracrRNA) and 0.3 µM of Cas9 protein according to protocols described previously (Shola et al., 2021). The injection mix was then delivered to 0.5 days of fertilized C57BL/6J mouse embryos using well-established pronuclear injection and surgical protocols (Shola et al., 2021).
Cells
Mouse primary stromal vascular fraction (SVF) cells were obtained from adipose tissues of 6- to 8-week-old male mice by collagenase digestion and plated on collagen I-coated dishes. SVF cells from epididymal white adipose tissue (eWAT) were grown in ITS media containing 1.5:1 mixture of low-glucose DMEM:MCDB201 supplemented with 2% FBS (Gemini), 1% ITS premix (Corning), 0.1 mM L-ascorbic acid 2-phosphate (Sigma), 10 ng/mL bFGF (Thermo), 0.5% penicillin/streptomycin (P/S, Gibco), and 0.2% primocin (InvivoGen). SVF cells from inguinal white adipose tissue (iWAT) and interscapular brown adipose tissue (BAT) were grown in DMEM/F-12 GlutaMAX medium (Gibco) containing 10% FBS and 1% P/S. Once grown to confluence, differentiation and maintenance of primary adipocytes across cell types were done using DMEM/F-12 GlutaMAX medium containing 10% FBS and 1% P/S. eWAT and iWAT SVF cells were induced to differentiate with an adipogenic cocktail (0.5 mM IBMX, 1 µM dexamethasone, 1 µM rosiglitazone, and 850 nM insulin) for the first 2 days, followed by 2 days of 1 µM rosiglitazone and 850 nM insulin, after which the cells were maintained in 850 nM insulin for additional 2-4 days. SVF cells from BAT were differentiated as above but with 17 nM insulin. Experiments with primary adipocytes were performed between days 6 and 8 of differentiation. All cultured primary adipocytes were checked for lipid accumulation under a phase-contrast microscope before studies. Primary SVF and adipocytes were maintained at 37ºC with 10% CO2.
Bone marrow-derived macrophages (BMDMs) were obtained from 8- to 10-week-old males. Femurs and tibias were dissected, cleaned, and sterilized with ethanol before flushed of bone marrow cells, which were plated onto petri dishes. Bone marrow cells were differentiated in RPMI-1640 medium (Gibco) supplemented with 20% heat-inactivated FBS (Sigma), 1% P/S, and 100 ng/mL M-CSF (Biolegend) for 6-7 days, changing media every 2-3 days. Differentiated BMDMs were washed, trypsinized, and plated onto TC-treated culture plates for overnight before studies were performed. Experiments with BMDMs were performed between days 6 and 7 of differentiation. BMDMs were differentiated and maintained at 37ºC with 5% CO2.
HEK293A cells were purchased from Invitrogen and grown using 4.5 g/L glucose DMEM (Gibco) supplemented with 10% FBS and 1% P/S at 37ºC with 5% CO2. Cells with passage number under 20 were used for adenovirus production. Cells were validated to be mycoplasma free.
Proteomic analysis using BONCAT
Conditioned medium generation
On day 6 of differentiation, primary adipocytes on collagen-coated 6-well plates were washed twice with warm PBS and pulsed with 1 mL/well of Met-free DMEM containing 10% dialyzed FBS, 1% P/S, 17 nM or 850 nM insulin, and either 0.1 mM AHA or 0.1 mM Met. Following 24 h incubation at 37ºC with 10% CO2, conditioned media (CM) from 6 wells (1 plate) were collected and pooled, filtered through a 0.22 µm PES membrane syringe filter unit, and supplemented with ½ tabs of EDTA-free cOmplete mini protease inhibitor cocktail (Roche) and PhosSTOP (Roche). CM was concentrated using a 3 kDa centrifugal filter unit (Millipore).
AHA administration and serum collection
Mice were injected with 0.1 g/kg/day AHA or PBS IP for 2 consecutive days and sacrificed 24 hours following the second injection. Following decapitation, truncal blood was collected, allowed to clot for 15 min at room temperature, and centrifuged at 2000×g for 15 min at 4 ºC to collect serum.
In-gel fluorescence analysis
Concentrated CM or serum was dialyzed with phosphate-buffered RIPA (10 mM phosphate buffer pH 7.2, 1% Triton X-100, 0.1% Na deoxycholate, 0.1% SDS, 140 mM NaCl) supplemented with EDTA-free cOmplete mini protease inhibitor cocktail (Roche) and PhosSTOP (Roche) using a 3 kDa centrifugal filter unit (Millipore) and protein concentration was determined using Pierce BCA Protein Assay Kit (Thermo Scientific) using a dilution series of bovine serum albumin as protein standards. Copper(I)-catalyzed azide-alkyne cycloaddition reaction with TAMRA-alkyne (Invitrogen) was performed by mixing 200 µg of CM proteins with 0.1 mM TAMRA-alkyne, 1 mM TCEP, 0.1 mM TBTA, and 1 mM of CuSO4 in phosphate-buffered RIPA and rotated end-over-end for 1 h at room temperature under protection from light. Following methanol/chloroform precipitation, the dried protein pellet was dissolved in Laemmli loading buffer. Following polyacrylamide gel electrophoresis, the gel was briefly washed with distilled H2O and imaged with a Typhoon 5400 imager (GE Healthcare) using 532 nm excitation and a 580 nm detection filter.
Enrichment of labeled proteins
Azide-labeled nascent protein in the concentrated CM was enriched using Click-iT™ Protein Enrichment Kit (Invitrogen). Serum was diluted 1:1 with the lysis buffer provided with the kit and subjected to enrichment. Enrichment and resin wash was performed following the protocol from Eichelbaum and Krijgsveld (2014).
On-bead digestion
Extensively washed beads were incubated with Lys-C endopeptidase (Wako) in 4 M urea and 0.14 M NH4HCO3 by shaking at 1400 rpm for 6 h at room temperature. The resin mixture was further digested by adding trypsin (Promega) in 2 M urea and 0.14 M NH4HCO3 and incubated by shaking at 1400 rpm overnight at room temperature. The following day, the digestion reaction was quenched by adding trifluoroacetic acid.
LC-MS/MS
Tryptic peptides were desalted (Rappsilber et al., 2007) and separated by reverse phase nano-LC-MS/MS (column: 12cm/75um C18 built-in-emitter column, Nikkyo Technos Co., Ltd. Japan, EasyLC 1200, Thermo Scientific) using a 70-minute analytical gradient, increasing from 2% B/98% A to 38%B/62%A (A: 0.1% formic acid, B: 80% Acetonitrile/0.1% formic acid) at 300 nL/min. The mass spectrometer (Fusion Lumos, Thermo Scientific) was operated in high/high mode (120,000 and 30,000 for MS1 and MS2, respectively). Auto Gain Control was set at 50,000 for MS2. MS1 scan range was set to m/z 375-1500 and m/z 110 was set as lowest recorded mass in MS2. One-point lock mass calibration was used. All data were quantified and searched against a Uniprot mouse database using MaxQuant (v. v. 1.6.0.13) (Cox et al., 2014). Oxidation of methionine and protein N-terminal acetylation were allowed as variable modifications, cysteine carbamidomethyl was set as a fixed modification, and two missed cleavages were allowed. The “match between runs” option was enabled, and false discovery rates for proteins and peptides were set to 1%. Protein abundances measured using label free quantitation (Tyanova et al., 2016).
Proteomic data analysis
Proteomic datasets were analyzed using Perseus v1.6.14.0 (Tyanova et al., 2016). Of the detected proteins, those flagged as reverse, only identified by site, and potential contaminants were excluded from the analysis. For quantitative analysis, LFQ or iBAQ intensities were employed as indicated; LFQ intensities were used for comparisons across samples, while iBAQ intensities were used to compare abundances across different proteins. Imputation of undetected data points for Log2(LFQ) intensities was performed by assigning values from a normal distribution of 0.3 width and 1.8 down shift. Principal component analysis (PCA) was performed with imputed Log2(LFQ) intensities. Scatterplot representation of Log2(LFQ) intensities was generated without imputation. Differentially secreted proteins were identified with ANOVA using permutation-based FDR, with FDR set at 0.01 and number of randomizations at 250.
GO cell component analysis
Gene symbols from detected proteins were submitted to Retrieve/ID mapping tool on the UniProt website (https://uniprot.org). List of genes that are annotated with the following gene ontology cell component terms were obtained: extracellular region (5576), extracellular space (5615), extracellular matrix (31012), plasma membrane (5886), cytosol (5829), nucleus (5634), mitochondrion (5739), endoplasmic reticulum (5783), and Golgi apparatus (5794).
Secretion prediction analysis
UniProt accession IDs of the detected proteins were submitted to Retrieve/ID mapping tool on the UniProt website (https://uniprot.org) to obtain the FASTA sequences, which were used as inputs for various secretion prediction algorithms using the web-based query system. We defined classically secreted proteins as having SignalP5.0 score > 0.5 and 0 or 1 predicted transmembrane domains by TMHMM2.0. Subcellular localization prediction analysis was performed using DeepLoc1.0 and searched for proteins whose predicted location is extracellular. PredGPI specificity score > 99% was used as the threshold to determine if a protein is expected to be GPI-anchored. Finally, proteins with SecretomeP2.0 score > 0.6 and SignalP5.0 score ≤ 0.5 were considered non-classically secreted.
Cluster analysis and functional annotation
Hierarchical clustering was performed on z-score-transformed Log2(LFQ) values using the complete-linkage method and split into 4 clusters by dendrogram. DAVID v6.8 was used to generate functional annotation of clusters (Huang et al., 2009). List of genes encoding the proteins of each of the 4 clusters were compared to a background gene list of total detected proteins in the proteomic dataset. Per cluster, top 4 overrepresented pathways in the gene ontology biological process terms were reported.
Adipose tissue enrichment analysis
To identify candidate genes enriched within brown and white adipose relative other tissue types as well to each other we used the BioGPS datasets (Su et al., 2004). The Mouse GNF1M Gene Atlas datasets (GSE1133) were downloaded from BioGPS portal (Su et al., 2004) and imported into Limma Bioconductor package (Ritchie et al., 2015) for Log2 transformation and differential expression analysis. All pair-wise comparisons for both brown adipose and white adipose tissues against all other tissue types were performed using limma as well as the direct comparison between brown and white adipose tissues. Genes with a Log2 fold change greater than 4 and a Benjamini-Hochberg-corrected FDR of 0.05 within pair-wise comparisons were considered significantly enriched. Genes were further scored by the total number of pair-wise comparisons where genes were found to be enriched in both adipose tissues, brown adipose tissue or white adipose tissue compared to other tissues in the tissue atlas.
RNA isolation, cDNA synthesis, and RT-qPCR
Total RNA was extracted from cultured cells using RLT buffer (Qiagen) and from tissues using TRIzol (Invitrogen) and purified using RNeasy Mini Kit (Qiagen). cDNA was synthesized from 1 µg of RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosciences). Power SYBR Green (Life Technologies) was used for RT-qPCR reactions performed with QuantStudio 6 Flex Real-Time PCR System (Thermo Scientific) in a 384 well format. Relative fold changes of mRNA levels were calculated using the ΔΔCT method with 18S rRNA as loading control. qPCR primers are provided in Supplementary Table 1.
Adipose tissue fractionation
Adipose tissues from 8-week-old C57BL/6J WT male mice were dissected and minced. eWAT and iWAT were digested in a buffer containing 10 mg/mL collagenase D (Roche), 2.4 mg/mL Dispase II (Roche), and 10 mM CaCl2 in PBS. For BAT, 2x BAT digestion buffer containing 125 mM NaCl, 5 mM KCl, 1.3 mM CaCl2, 5 mM glucose, 1% P/S, and 4% BSA was prepared, which was diluted 1:1 with PBS and used to dissolve collagenase B (Roche) at a final concentration of 1.5 mg/mL. Following collagenase digestion of the tissues in a 37ºC water bath, the mature adipocyte fraction was separated from the SVF pellet by centrifugation at 500×g for 10 min at 4ºC. The two fractions were transferred to two separate tubes, washed with DMEM/F-12 GlutaMAX containing 10% FBS and 1%P/S, and vortexed in TRIzol for RNA extraction.
RNA-Sequencing and immune cell deconvolution
Extracted RNA samples were analyzed for RNA integrity number (RIN) using the Bioanalyzer (Agilent) and sequenced using Illumina NovaSeq at the Rockefeller University Genomics Resource Center. Reads were trimmed with Cutadapt, aligned to mm10 reference genome using STAR, and quantified using featureCounts. Differential gene expression analysis was performed using DESeq2 (Love et al., 2014). Pathway analysis was performed using clusterProfiler (Yu et al., 2012). Deconvolution analysis was performed with CIBERSORTx (Newman et al., 2019) using ImmuCC signature matrix (Chen et al. 2017).
Tissue origin prediction
Mouse tissue mRNA sequencing data from ENCODE was downloaded from GSE36026. Reads were mapped and quantified as above and gene expression was normalized using DESeq2. Genes detected in mouse nascent serum were selected for t-SNE analysis. Briefly, average normalized expression in a tissue was divided by summed expression across tissues. Tissue with the highest relative expression was designated as the highest expressing tissue for a gene. t-SNE analysis was performed on relative expression values with R package Rtsne (https://github.com/jkrijthe/Rtsne) using a perplexity of 30 and maximum iteration of 1,000.
Immunoblot
Upon collection, conditioned medium (CM) was filtered using a 0.22 µm PES membrane syringe filter unit to remove cell debris. CM was concentrated using a 3 kDa centrifugal filter units (Millipore), and protein concentration was determined using Pierce BCA Protein Assay Kit (Thermo Scientific) using a dilution series of bovine serum albumin as protein standards. Mouse serum samples were loaded at equal volume. Pre-cast polyacrylamide gels were used for electrophoresis, after which protein was transferred to PVDF membrane using standard techniques. Immunoblots were incubated with indicated primary antibodies and developed using Western Lightning Plus-ECL (PerkinElmer) and imaged on an autoradiographic film or using a Bio-Rad Gel Doc system.
Co-immunoprecipitation
Serum was diluted 1:1 with PBS containing 0.02% Tween-20 (PBS-T) and incubated with α-FLAG M2 beads (Sigma) overnight at 4ºC. Following wash with PBS-T, bound proteins were eluted by heating the beads at 70ºC in Laemmli buffer containing 50 mM glycine buffer pH 2.8 and 9% (v/v) β-mercaptoethanol.
Adenovirus production and purification
Adenoviral vectors were created using the AdEasy system (Luo et al., 2007). C-terminally 3xFLAG-tagged murine LRG1 was cloned into pAdTrack-CMV (AddGene) linearized with XhoI (NEB) and HindIII (NEB) using In-Fusion® HD Cloning Kit (Takara). pAdTrack-CMV and pAdTrack-CMV-LRG1-FL plasmids were linearized with PmeI (NEB) and recombined into pAdEasy-1 vector via electrophoretic transformation of recombination-competent BJ5183-AD-1 cells (Agilent) with the linearized product and selection for kanamycin-resistant clones. Plasmids from validated clones were transformed into recombination-deficient XL-10 Gold ultracompetent cells (Agilent), which were used to generate pAd-eGFP and pAd-LRG1-FL plasmids and purified using Plasmid Maxi Kit (Qiagen).
Crude adenovirus was produced by transfecting PacI (NEB)-linearized pAd vectors into HEK293A cells (Invitrogen), which were incubated at 37ºC with 5% CO2 for 10-14 days with media supplementation every 3-5 days until most cells showed cytopathic effect/detachment. Both cells and the culture medium were collected, lysed by 3 cycles of freeze-thaw between dry ice-ethanol and room-temperature water baths, and centrifuged at 3500×g for 15 min at 4ºC to obtain the supernatant crude virus. Round 1 amplification product was obtained by transducing HEK293A cells with the crude virus and repeating the above collection, lysis, and centrifugation steps.
To obtain round 2 amplification product, twelve 15 cm plates of HEK293A cells were transduced with round 1 adenovirus and incubated at 37ºC with 5% CO2 until most cells demonstrated cytopathic effect. As with previous rounds, cells and media were collected, lysed by freeze-thaw cycles, and centrifuged to obtain the supernatant. The supernatant was treated with benzonase, and adenoviral particles were purified from the crude mixture using the Vivapure AdenoPACK 100 kit (Sartorius). Purified virus was dialyzed with buffer containing 20 mM Tris pH 8, 25 mM NaCl, and 2.5% (w/v) glycerol and concentrated using a 100 kDa centrifugal filter unit provided with the kit. Titer of the adenovirus was determined using Adeno-X Rapid Titer Kit (Takara).
AAV8 vector preparation
C-terminally 3xFLAG-tagged LRG1 was cloned into pENN.AAV.CB7.CI.eGFP.WPRE.rBG (Addgene) linearized with EcoRI (NEB) and BglII (NEB) using In-Fusion® HD Cloning Kit (Takara). The original eGFP-expressing and cloned LRG1-FL plasmids were transformed into Stable Competent E. coli (NEB), purified using Plasmid Maxi Kit (Qiagen), and shipped to Penn Vector Core (PA, USA) for AAV8 production.
In vivo adenovirus/AAV8 transduction
In vivo adenoviral transduction studies were performed using purified adenovirus from second round of amplification. Adenovirus was injected at a dose of 1010 pfu/mouse. AAV8 was injected at 1011 GC/mouse. The mice were briefly anesthetized with isoflurane for virus injection via the retroorbital route. Following injection, the mice were quarantined in an ABSL-2 housing room for 72 h before transferred back to regular housing conditions.
H&E section preparation/CLS quantification
Dissected tissues were fixed in 10% neutral buffered formalin for 3 days at room temperature and transferred to 70% ethanol. Paraffin embedding, sectioning, and H&E staining was performed by the Memorial Sloan Kettering Cancer Center Laboratory of Comparative Pathology. The slides were imaged using a wide-field fluorescence/brightfield/DIC microscope (Zeiss) at the Rockefeller University Bioimaging Resource Center. Crown-like structures (CLS) were identified as any adipocyte in a field of view with cellular infiltrates indicated by nuclear staining surrounding a majority of adipocyte perimeter. Objectives were used as indicated and chosen based on CLS enumerability (<30 CLS per field). 5 fields from 3 animals were quantified per group.
Multiplex cytokine panel
Mouse serum samples were diluted 1:1 with PBS, snap frozen using liquid N2 and shipped to Eve Technologies (Alberta, Canada) on dry ice. The Mouse Cytokine Array / Chemokine Array 31-Plex (MD31) panel was used to quantify the levels of cytokines and chemokines
Cytochrome c clearance assay
12-week-old chow-fed LRG1-KO and WT littermate males were injected retro-orbitally with 40 mg/kg equine cytochrome c (Cyt c) in PBS. Blood was collected from the tail vein immediately prior to injection (0 min) and 5 min, 15 min, 30 min, 1 h, 2 h, 4 h, and 6 h post-injection into EDTA-coated capillary tubes and kept in ice until further processing. During blood collection, each mouse was placed on a metal grating above a clean plastic wrap to allow collection of excreted urine, if any. Plasma was isolated via centrifugation at 2000×g for 15 min at 4ºC. Immunoblot against Cyt c was performed with WT and KO plasma samples run pairwise to enable relative quantification of Cyt c signal. Quantification was performed using ImageJ (Schneider et al., 2012).
Statistical analysis
Unless otherwise noted, data are presented as mean ± SEM, with n number specified in the figure legends. Statistical analyses were performed with GraphPad Prism 9. Binary comparisons were performed with Welch’s t-test to account for possible difference in variance. Statistical analysis of data involving 3 or more conditions (levels) of a single variable was performed using one-way ANOVA followed by Dunnett post hoc tests to compare every mean with a control mean. Data measured across multiple time points as in GTT and ITT were analyzed with repeated measures two-way ANOVA, reporting group factor P-values. Analysis of data from a two-factor experimental setup was performed with two-way ANOVA or two-way mixed effects ANOVA in the case of an uneven n number, reporting group factor P-values. For post hoc tests, Tukey method was used when comparing every mean with every other mean and Šídák method was employed when a selected set of means were compared.