U87 and U251 cell culture
Glioma cell lines (U87 and U251 cells) were obtained from Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). The cell typing was verified, and there was no mycoplasma or bacteria contamination. The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) at 37℃ with 5% CO2. The cells in logarithmic phase were used for the subsequent experiments.
Isolation, culture and identification of GSCs
The adherent U87 cells cultured in DMEM/F12 containing 10% FBS were prepared into single cell suspension. The cells were resuspended in serum-free medium (2 × 105 cells/mL) and cultured in saturated humidity at 37℃ with 5% CO2. Then the cells were incubated with GSC markers CD133 (1:300, ab33922, Abcam, Cambridge, MA, USA) and Nestin (1:200, ab105389, Abcam) at 4℃ overnight. After the cell slide was rinsed with phosphate-buffered saline (PBS), the cells were incubated with the secondary antibody immunoglobulin G (IgG) (1:500, ab150088, Abcam) at 37℃ for 1 h. GSCs were screened and isolated using flow cytometry. The differentiation ability of GSCs was evaluated using immunofluorescence. Single cell-derived tumor spheres in serum-free medium were collected and seeded into 6-well plates. The expressions of CD133, glial fibrillary acidic protein (GFAP) and neuron specific enolase (NSE) were detected. The expressions of CD133, GFAP and NSE were detected after the cells were cultured in serum medium for 1 week to evaluate the differentiation ability of GSCs.
Isolation, culture and identification of EVs
U87 cells were washed with PBS twice. The medium containing 10% FBS was replaced by 10% EVs-free medium. The cells were cultured for another 48–72 h and then the cell supernatant was collected, followed by the extraction of EVs using differential centrifugation [14]. All the centrifugation steps were completed at 4℃ and the rest steps were performed on ice. The precipitates after centrifugation were resuspended with PBS and centrifuged once again. Finally, the precipitates were resuspended with 50–100 µL PBS and stored at -80℃. The size of EVs was measured by Nanosight [15]. The EV marker proteins CD44 (1:1000, ab189524, Abcam) and CD63 (1:1000, ab134045, Abcam) were identified using Western blotting. The EVs were resuspended with 4% paraformaldehyde, and then 5 µL EVs were dripped onto the electron microscope mesh and fixed in a dry environment for 20 min. The EVs were washed with PBS and incubated with 1% glutaraldehyde for 5 min. Following washing with distilled water 8 times (2 min/time), EVs were incubated with uranyl oxalic acid solution (pH = 7) for 5 min and hydroxypropyl methylcellulose for 10 min on ice. The excess liquid was removed, and EVs were let stand for 5–10 min and observed under an electron microscope (Zeiss AG, Oberkochen, German). The concentration of EVs was quantified by bicinchoninic acid (BCA) assay kit (ab102536, Abcam). EVs at concentration of 10, 20 and 30 µg/mL were used for subsequent experiments.
Detection of the uptake of GSCs-EVs by glioma cells
GSCs-EVs were labeled with PKH-26 red fluorescent cell linker kit (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany). Briefly, PKH-26-labeled GSCs-EVs were cultured with U87 cells at 37℃ for 12 h. Afterwards, the cells were rinsed with PBS twice, fixed with methanol for 20 min and stained with DAPI for 20 s. The stained cells were observed under a fluorescence microscope (Olympus, Tokyo, Japan) to determine the uptake of PKH-26-labeled GSCs-EVs by U87 and U251 cells.
Cell treatment and grouping
U87 and U251 cells were treated with 10, 20 and 30 µg/mL EVs. GSCs were added with EV inhibitor GW4869 (Sigma-Aldrich), and then the supernatant was collected to treat U87 and U251 cells as the control group. miR-26a inhibitor and miR-NC (GenePharma, Shanghai, China) were transfected into GSCs using Lipofectamine 2000 (R&D Systems, Minneapolis, MN, USA), and the extracted EVs were recorded as EVs + inhibitor and EVs + inhibitor-NC respectively. U87 and U251 cells were treated with 30 µg/mL EVs. miR-26a mimic, miR-NC, Krüppel-like factor4 (KLF4) overexpression vector pcDNA-KLF4 and control vector pcDNA-NC (GenePharma) were transfected into U87 cells using Lipofectamine 2000. The subsequent experiments were performed 48 h later.
Detection of cell proliferation
The cell proliferation was detected using MTT and EdU assay. The cells at passage 3 in logarithmic phase were prepared into single cell suspension (l × 105 cells/well). The cell proliferation was detected using the MTT cell proliferation kit (ab211091, Abcam) and Cell-Light™ EdU assay kit (ab219801, Abcam).
Detection of cell invasion and migration
The cell invasion and migration were evaluated by matrix-coated and uncoated 24-well Transwell chamber. Briefly, U87 cells were added into the apical chamber and cultured in serum-free medium containing 10, 20 and 30 µg/mL GSCs-EVs. The complete medium containing 10% FBS was supplemented to the basolateral chamber. After 48 h, the cells in the apical chamber were removed with cotton swabs, and the remaining cells were fixed in 4% paraformaldehyde. The cells in the basolateral chamber were removed with a cotton swab, and the migrated cells were fixed with methanol and stained with crystal violet. The permeable membrane was observed under a microscope.
Detection of glucose and lactic acid
GSCs were seeded into the 24-well plates (200 µL medium/well). After 24 h, the medium was replaced by fresh medium containing 10, 20 and 30 µg/mL GSCs-EVs, and the cells were incubated for another 48 h. Then, the supernatant and cells were collected. The levels of glucose and lactic acid were determined using the glucose and lactic acid detection kits (Sigma-Aldrich).
Adenosine triphosphate (ATP) detection
GSCs were lysed, and then the lysate was centrifuged at 15000 rpm and 4℃ for 10 min. ATP concentration was measured using ATP detection kit and a microplate Reader (Bio-Rad 680, Bio-Rad, Hercules, CA, USA).
Dual-luciferase reporter gene assay
The binding site between miR-26a and KLF4 was predicted by Targetscan (http://www.targetscan.org/vert_72/). The wild type (WT) vector (KLF4-WT) and the mutant type (MUT) vector (KLF4-MUT) were constructed. Then, 0.5 µg KLF4-WT or KLF4-MUT were co-transfected with 40 nmol miR-26a mimic or miR-NC into 293T cells (Shanghai Institute of Biochemistry and Cell Biology, CAS) using Lipofectamine 2000. The cells were collected in the lysis buffer (Ambion, Austin, TX, USA) 48 h later. Luciferase activity was tested using the dual-luciferase reporter gene assay kit (D0010, Solarbio Science & Technology Co., Ltd, Beijing, China) and fluorescence intensity was testing using the GLomax20/20 Luminometer (Promega, Madison, WI, USA).
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted using RNAiso Plus (Takara, Otsu, Shiga, Japan) and TRIzol LS Reagent (Takara). The reliability of extracted RNA was verified by formaldehyde denaturation electrophoresis. Then, the extracted RNA was reverse transcribed into cDNA using the PrimeScript™ RT kit (Takara). The relative expression of genes were quantified by standard RT-qPCR using SYBR® Premix Ex Taq™ II kit (Takara), with β-actin or U6 as the internal reference. Primer sequences are illustrated in Table 1.
Table 1
Primer sequence for RT-qPCR
Gene | Forward | Reverse |
miR-26a | GCCTAACCCAAGAAGGGAAA | TCCCTCTCATCTGGACAACC |
PFK1 | GGTGATGCTCCCGGTATGAA | GGGCACCCTTCAATCTACCC |
HK2 | TGCCAAGCGTCTCCATAA | GGTCAGCCAGACGGTAA |
PKM2 | GGGTTCGGAGGTTTGATG | ACGGCGGTGGCTTCTGT |
KLF4 | TTAATGAGGCAGCCACCTGG | CCTCCTCTATGGCAGGGAGT |
β-actin | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
Western blotting
Total protein of cells was extracted using radio-immunoprecipitation assay buffer containing phenylmethylsulfonyl fluoride (Beyotime, Shanghai, China). The protein concentration was tested using the BCA assay. Equal protein was separated on 10% SDS-PAGE and transferred onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). The membranes were blocked in 5% skim milk-tris buffered saline tween (TBST) and incubated with the primary antibodies CD44 (1:1000, ab189524, Abcam), CD63 (1:1000, ab134045, Abcam), calnexin (1:20000, ab92573, Abcam), PFK1 (1:1000, ab155564, Abcam), HK2 (1:1000, ab209847, Abcam), PKM2 (1: 1000, ab137852, Abcam), KLF4 (1: 2000, ab215036, Abcam), p-PI3K (1: 500, ab182651, Abcam), p-Akt (1:1000, ab38449, Abcam), and β-actin (1:2000, ab8227, Abcam) at 4°C overnight. Following TBST washing, the membranes were incubated with the horseradish peroxidase-conjugated goat anti-rabbit IgG (1:2000, ab205718, Abcam) for 1 h. Next, the membranes were developed and visualized using the enhanced chemiluminescence reagent (Millipore). The gray value of each band was quantified using Image Pro Plus 6.0 (Media Cybernetics, Silver Spring, MD, USA) with β-actin as the internal reference.
Statistical analysis
Data analysis was introduced using the SPSS 21.0 (IBM Corp., Armonk, NY, USA). Kolmogorov-Smirnov method was adopted to check whether the data were in normal distribution. Data are expressed as mean ± standard deviation. The t test was adopted for comparison between two groups. One-way analysis of variance (ANOVA) was employed for the comparisons among multiple groups, following Tukey's multiple comparisons test. The p < 0.05 meant a statistically significance.