Isolates and culture conditions.
In 2019, 138 single-spore field isolates of L. theobromae were obtained from diseased mango fruits in Hainan Province, China, previously identified and preserved in our laboratory. At 28°C in the dark, the isolates were grown on a potato dextrose agar (PDA) medium.
Determination of the baseline sensitivity of field isolates to difenoconazole.
A mycelial growth inhibition assay was used to investigate the baseline sensitivity to difenoconazole of 138 L. theobromae isolates13. To prepare stock solutions, difenoconazole (97.2%; Zhengye Chemical Industrial Co., Hainan, China) was dissolved in 100% acetone to obtain 5×103 µg/ml solutions. A mycelial plug (5 mm in diameter) from the edge of the 3-day-old culture of each isolate was inoculated in 90 mm diameter Petri plates containing difenoconazole PDA media. The final concentration of acetone solvent in the medium was 0.1%. The difenoconazole concentrations of 51.2, 12.8, 3.2, 0.8, 0.2 µg/ml, as well as a control medium with the same amount of acetone but no fungicide. Inoculated plates were cultured in the dark at 28°C. The diameter of each colony was measured, and the inhibition rate of mycelial development calculated after cultured for 36 h. There were three replicate plates per treatment. The entire experiment was repeated twice independently. The frequency distribution of 138 EC50 values of L. theobromae was plotted to represent the baseline sensitivity. The baseline sensitivity level of L. theobromae was used to develop classification criteria for difenoconazole sensitive phenotypes14,13. The resistance factor (RF) of each isolate to fungicide was computed using the baseline sensitivity: Sensitive isolates (S): RF < 5; Resistant isolates (R): RF > 515.
Cross-resistance of difenoconazole with other fungicides.
The cross-resistance of difenoconazole with other regularly used fungicides was investigated using 20 isolates. These comprised DMIs fungicides tebuconazole and five fungicides of other action modes, which were carbendazim (benzimidazole), iprodione (dicarboximides), bromothalonil (bromomethyl glutaronitrile), fludioxonil (phenylpyrrole) and pyraclostrobin (strobilurin). As previously stated, EC50 values were calculated using a mycelial growth inhibition experiment. The EC50 values of the fungicides tested were used to determine cross-resistance correlations. The experiment was conducted three times independently, using three replicate plates for each treatment.
Cloning and Sequencing of LtCYP51 Gene.
Mycelia of L. theobromae were snap-frozen in liquid nitrogen and processed with tungsten beads in a LUKYM-II Mixer-Mill to extract total genomic DNA from 138 isolates (Guangzhou Luka sequencing instrument Co., LTD, Guangzhou, China). Total genomic DNA was extracted according to the manufacturer's instructions using the E.Z.N.A.® HP Plant DNA Mini kit (Omega Bio-Tek, Norcross, United States). Primer pairs, LtCYP51-F1/LtCYP51-R1, Per-1F/Per-1F (Table 1), were designed to amplify the LtCYP51 coding sequence and LtCYP51 promoter of resistant and sensitive isolates. Amplications were performed in a My Cycler thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA). A 40 µL reaction volume was used for PCR amplification, with 20 µL of 2 × Phanta Max Master Mix, 0.8 µL of template DNA, 1.6 µL of (10 mM) each primer, and 16 µL of ddH2O. The PCR settings for the coding sequence were 95°C for 3 min, followed by 35 cycles of 95°C for 30 s, 58°C for 50 s, and 72°C for 90 s, followed by a final 5-min extension at 72°C.
Table 1
Primers utilized in this study.
Primers
|
Sequence (5’→3’)
|
Description
|
Per-1F
|
GCCAACAGCCACGGATGAT
|
|
Amplification of the promoter region of the Lt CYP51 gene
|
Per-1R
|
GCCATAGGTGACGGTGCTG
|
|
Lt-CYP51F
|
CCCTCCGTCTCCCTACACCT
|
|
Amplification of the coding region of the Lt CYP51 gene
|
Lt-CYP51R
|
TTCTCCCTCCTCTCCCAAA
|
|
RT-LtF
|
GGATTGTGCTTCGTCTCGC
|
|
Quantitative RT-PCR primers for analysis of Lt CYP51 expression
|
RT-LtR
|
CGTCTCCTTGACCACCTGCT
|
|
RT-Act LtF
|
GGAGATGAGGCACAGTCG
|
|
Amplification of the actin gene
|
RT-Act LtR
|
GCGGTGGTGGAGAAAGAGT
|
|
For the promoter, other conditions are the same as the coding region, but the extension time is 15 s. With a Tolo PCR Clean-Up Kit (Tolo Biotech Co., LTD, Shanghai, China), PCR products were purified. The PCR fragment was ligated into p ESI-blunt vector (YEASEN Biotech Co.Ltd) and sequenced with vector primers M13F and M13R at Tianyihuiyuan Biotech Co., Ltd (Guangzhou, China).
The LtCYP51 DNA sequence was studied using the programs DNAMAN (version 6.0; LynnonBiosoft, U.S.A.) and InterPro Scan (http://www.ebi.ac.uk/interpro/search/sequence-search), and it was compared to fungal of other LtCYP51 genes. The amino acid sequences of the LtCYP51 genes from difenoconazole-resistant and sensitive isolates were compared using the computer program EMBOSS Transeq (https://www.ebi.ac.uk/emboss/transeq/), which translated the DNA sequences into amino acid sequences using standard code.
Quantitative expression of LtCYP51 Gene. Among the 30 isolates used for amino acid mutation analysis, two sensitive isolates (YC70 and JS10) and six resistant isolates (LD10, SY31, YZ90, DZ11, SY05 and YC80) were randomly selected to study the expression of LtCYP51 gene. The EC50 values of 8 isolates (Table 2). Five mycelial plugs were transferred into a flask containing 100 ml of potato dextrose broth (PDB) and incubated at 28°C for 24 h on a rotary shaker at 150 rpm. Three flasks were treated with difenoconazole to reach a final concentration of 150 µg/ml, with three replicates. Three flasks containing 100 ml of PDB were used as untreated controls. After being treated with difenoconazole for 12 h, the mycelia of each isolate were removed for RNA extraction16. Total RNA was extracted using the TIANGEN RNA simple Total RNA kit (Tiangen Biotech Co., Ltd, Beijing, China), and cDNA was synthesized using the HiScript III 1st Strand cDNA Synthesis Kit with g DNA Eraser (Vazyme Biotech Co., Ltd, Nanjing, China), following the manufacturer's instructions. Every reaction has three biological replicates and three technological replicates.
Table 2
The EC50 values of Lasiodiplodia theobromae isolates to seven fungicides
Isolates
|
EC50 ± SD (µg/ml)a
|
Difb
|
Car
|
Pyr
|
Flu
|
Bro
|
Ipr
|
Teb
|
YC80
|
7.59 ± 0.23
|
8016.29 ± 658.34
|
1913.83 ± 158.46
|
0.04 ± 0.01
|
11.68 ± 1.92
|
0.30 ± 0.06
|
0.97 ± 0.11
|
SY06
|
9.63 ± 0.66
|
3.37 ± 0.28
|
1.75 ± 0.25
|
0.08 ± 0.01
|
9.52 ± 1.27
|
0.53 ± 0.09
|
1.87 ± 0.13
|
LD13
|
1.99 ± 0.22
|
0.02 ± 0.01
|
344.93 ± 45.72
|
0.17 ± 0.02
|
14.89 ± 1.63
|
0.36 ± 0.05
|
0.33 ± 0.08
|
SY34
|
10.14 ± 0.91
|
1792.64 ± 176.28
|
213.41 ± 19.33
|
0.04 ± 0.01
|
10.02 ± 1.15
|
0.23 ± 0.06
|
1.11 ± 0.09
|
YC70
|
0.97 ± 0.52
|
0.09 ± 0.01
|
79 ± 5.38
|
0.03 ± 0.01
|
2.08 ± 0.46
|
0.23 ± 0.07
|
0.07 ± 0.01
|
SY05
|
6.52 ± 0.40
|
0.38 ± 0.02
|
260.01 ± 19.62
|
0.05 ± 0.01
|
7.83 ± 0.98
|
0.37 ± 0.08
|
0.68 ± 0.07
|
SY31
|
6.24 ± 0.33
|
1.08 ± 0.14
|
83.21 ± 8.45
|
0.26 ± 0.03
|
5.04 ± 0.56
|
0.25 ± 0.09
|
0.60 ± 0.08
|
DZ11
|
8.29 ± 0.36
|
2.68 ± 0.38
|
429.48 ± 47.83
|
0.04 ± 0.01
|
5.33 ± 0.40
|
0.40 ± 0.06
|
0.84 ± 0.09
|
AM82
|
1.03 ± 0.85
|
5447.84 ± 529.11
|
210.77 ± 20.45
|
0.11 ± 0.02
|
7.33 ± 0.72
|
0.54 ± 0.08
|
0.17 ± 0.02
|
YZ31
|
7.22 ± 0.63
|
8.39 ± 0.96
|
133.87 ± 11.23
|
0.06 ± 0.01
|
6.46 ± 0.75
|
0.42 ± 0.03
|
0.81 ± 0.09
|
CJ20
|
2.61 ± 0.57
|
0.0001 ± 0.00
|
25.9 ± 1.99
|
0.11 ± 0.02
|
8.90 ± 0.66
|
0.23 ± 0.05
|
0.47 ± 0.06
|
YZ01
|
5.39 ± 0.92
|
1.17 ± 0.16
|
8.09 ± 0.93
|
0.09 ± 0.01
|
7.36 ± 0.97
|
0.32 ± 0.04
|
0.42 ± 0.05
|
CJ01
|
0.73 ± 0.33
|
0.52 ± 0.04
|
54.02 ± 6.35
|
0.15 ± 0.02
|
10.54 ± 0.94
|
0.30 ± 0.04
|
0.40 ± 0.07
|
AM24
|
2.22 ± 0.30
|
1.15 ± 0.12
|
9.98 ± 1.21
|
0.10 ± 0.01
|
8.90 ± 0.81
|
0.25 ± 0.16
|
0.40 ± 0.06
|
SY26
|
8.53 ± 1.17
|
1.05 ± 0.10
|
6.07 ± 0.78
|
0.21 ± 0.03
|
6.07 ± 0.83
|
0.35 ± 0.19
|
0.98 ± 0.08
|
LD34
|
0.33 ± 0.29
|
0.68 ± 0.05
|
16.58 ± 1.75
|
0.08 ± 0.01
|
16.58 ± 1.74
|
0.42 ± 0.05
|
0.89 ± 0.09
|
LD10
|
6.64 ± 0.41
|
8537.14 ± 721.73
|
230.67 ± 20.65
|
0.12 ± 0.02
|
9.16 ± 0.95
|
0.25 ± 0.07
|
0.63 ± 0.09
|
SY02
|
11.56 ± 0.72
|
2.63 ± 0.45
|
58.36 ± 4.92
|
0.17 ± 0.05
|
8.05 ± 0.75
|
0.31 ± 0.09
|
1.59 ± 0.03
|
JS10
|
0.65 ± 0.22
|
1.32 ± 0.23
|
211.39 ± 19.43
|
0.05 ± 0.01
|
8.45 ± 0.92
|
0.31 ± 0.08
|
0.07 ± 0.01
|
YZ90
|
9.34 ± 0.20
|
5.59 ± 0.46
|
0.0008 ± 0.00
|
0.03 ± 0.01
|
5.59 ± 0.63
|
0.36 ± 0.09
|
0.98 ± 0.09
|
aValues in a column indicate EC50 means ± standard deviation (SD). bDif = difenoconazole, Car = carbendazim, Pyr = pyraclostrobin, Flu = fludioxonil, Bro = bromothalonil, Ipr = iprodione, Teb = tebuconazole. |
Real-time PCR was carried out in a total volume of 20 µL using the qTOWER3 G REAL-TIME PCR thermocycler (Analytik Jena AG, Jena, Germany). To amplify the genes, the 2 × ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd, Nanjing, China) was employed. The actin gene was amplified as a reference using the primer pair RT-Act LtF/RT-Act LtR to standardize the quantification of LtCYP51 expression17. Three repeats of the experiments were carried out.
Statistical analysis.
The inhibition rates were converted to the probability values, and difenoconazole concentrations were log 10-transformed before using a line regression model. The effective concentration to inhibit mycelial growth by 50% (EC50) was calculated by the regression equation. The EC50 values were checked for homogeneity of variances using Levene’s test, then the EC50 values were calculated for each isolate by combining the data from both replications. The Shapiro-Wilk test was used to determine the normality of the frequency distribution of difenoconazole sensitivity, and the outliers were detected using the boxplot in SPSS 21.0. (IBM SPSS Statistics Version 21.0; IBM Corp., Armonk, NY, USA). The histograms were built utilising log 10-transformed EC50 values when the outliers were removed14,13. Spearman's rank correlation coefficient using log-transformed EC50 values was used to examine cross-resistance among seven fungicides18,19.To assess the differences in the relative expressions of gene, a one-way ANOVA with LSD test (p < 0.01). The difference of mean expression level was compared by Mann–Whitney U-test (p < 0.001). DNAMAN software was used to examine DNA sequences. (version 6.0; LynnonBiosoft, U.S.A.).