Animals and surgery for SCI
All procedures were implemented in accordance with the Institutional Animal Care and Use Committee of Capital Medical University (Beijing, China). A total of 109 adult female Wistar rats (9-weeks-old, 220–240 g) were purchased for studies from the Vital River Laboratory Animal Technology Co., Ltd (Beijing, China), including seven rats that were excluded from further assessments due to death. In the first stage of our study, 48 rats were used to detect the expressions of IL-1β at 0, 6, 12, and 24 h after SCI, which were divided into two groups at each time point: SCI + Vehicle and SCI + Riluzole (n = 6/group). In the second stage, 54 rats were randomly divided into three groups: Sham, SCI + Vehicle, and SCI + Riluzole (n = 18/group) for the detection of neuronal apoptosis and long-term motor function in SCI rats.
Rats were secured to the table after being anesthetized with a mixture of oxygen and isoflurane (1.5–2.0%). Fur over the surgical area was shaved and the skin disinfected. A dorsal midline incision was made at the T6 to T12 levels, and the skin, subcutaneous tissue, and fascia were cut. The spinous processes were exposed by blunt dissection of the underlying muscle layers. The thoracic vertebrae at T9, T10, and T11 were excised to expose the spinal cord. The SCI model was generated by allowing a rod (height: 25 mm; weight: 10 g; diameter: 3 mm, Impactor Model III; Rutgers University, New Brunswick, NJ, USA) to fall onto the spinal cord. After injury, muscles and skin were sutured under sterile conditions. SCI rats were administered an intraperitoneal (i.p.) injection of 6 mg/kg riluzole or the same volume of vehicle immediately after surgery. Finally, the rats were kept warm with an electric blanket until they had fully recovered from the anesthesia.
Animal care
The rats were housed at a constant ambient temperature with a 12 h light-dark cycle and provided with food and water ad libitum. SCI rats were artificially urinated four times a day to prevent urinary tract infections and interventional bladder filling. The hind limbs of the rats were washed with saline, and the skin was dried with a hair dryer.
Locomotion assay
The Basso, Beattie, Bresnahan (BBB) (Basso et al. 1995) locomotor rating scale and inclined plane test (Rivlin et al. 1977) were used to evaluate the functional recovery of rats on postoperative days 1, 3, 7, 14, 21, 28, 35, and 42. The BBB score is based on the animal’s foot placement, limb movement, gait, and coordination. A score of 21 is normal. For the evaluation of hind limb strength, we performed the inclined plane test. Animals were placed on an inclined plane, which was then angled until they could no longer maintain their footing. The time and angle were recorded. The test was repeated three times for each rat, and data were averaged for analysis.
Electrophysiological evaluation
Motor evoked potentials (MEPs) were recorded to evaluate the recovery of the motor systems after SCI. The MEPs test assay was performed as previously described (Xu et al. 2017). Briefly, rats were anesthetized with gas mixtures of oxygen and isoflurane. Stimulator electrodes were inserted subcutaneously above the anterior fontanelle and the active recording electrodes were placed in each Achilles’ tendon for measurement of MEPs. The N1-P1 amplitude and N1 peak latency were used to analyze the effect of neurological recovery.
Nissl straining
On day 1 after surgery, rats were euthanized with a mixture of oxygen and isoflurane (1.5–2.0%), perfused with saline, and fixed with 4% paraformaldehyde. The spinal cord was then removed, fixed in 4% paraformaldehyde solution, and dehydrated in 30% sucrose for 3 days before being stored at 4°C. Frozen spinal cords were cut into 20 µm sections with a microtome (CM1950; Leica, Wetzlar, Germany). According to the manufacturer’s instructions, we stained the sections with Nissl stain. Finally, we acquired brightfield images by light microscopy (Nikon, Tokyo, Japan).
Immunofluorescence
Frozen sections (20 mm) were permeabilized three times with phosphate-buffered saline/Tween 20 (PBST) for 15 min, blocked with 10% goat serum for 30 min, and incubated overnight with primary antibody to NeuN (ab104224, 1:200: Abcam, Cambridge, UK), cleaved caspase-3 (ab49822, 1:200; Abcam), Iba I (01919741, 01226723, 1:100; Wako, Osaka, Japan), ST2 (ab25877, 1:100; Abcam), CD16 (ab109223, 1:100; Abcam), or CD206 (sc-58986, 1:200; Santa Cruz Biotechnology, Santa Cruz, CA, USA). Subsequently, the sections were washed in PBST for 30 min and incubated with secondary antibody (A32723, A32754, 1:100; Invitrogen, Carlsbad, CA, USA) for 8 h. Finally, sections were washed in PBST for 30 min and then incubated with 4′,6-diamidino-2-phenylindole for 30 s. The stained sections were analyzed in fields/sections with a confocal laser scanning microscope (Nikon).
Western blot analysis
Protein expressions of GAP-43 (8945, 1:1,000; Cell Signaling Technology, Danvers, MA, USA), ST2 (ab25877, 1:2,000; Abcam), IL-33 (ab207737, 1:2,000; Abcam), CD16 (ab109223, 1:2,000; Abcam), and CD206 (sc-58986, 1:1,000; Santa Cruz Biotechnology) were determined in spinal cord homogenates by western blot analysis as previously described [25]. After the protein concentration was measured using bovine serum albumin, the proteins were separated by SDS-PAGE and then transferred onto a polyvinylidene difluoride membrane. Next, the membranes were blocked with 5% nonfat milk for 60 min and incubated with primary antibodies for 12 h at 4° C. Finally, the membranes were incubated with secondary antibody (A32723, A32754, 1:5,000; Invitrogen) for 1 h, and images were acquired (BioSpectrum 515; LabMode, Borehamwood, UK). Image J (National Institutes of Health, Bethesda, MD, USA) was used to visualize the reaction products for quantifying protein expression.
Real-time PCR
Total RNA was extracted from spinal cord tissue with TRIzol reagent (Invitrogen), and cDNA was synthesized in accordance with the instructions (Tiangen Biotech, Beijing, China). We performed real-time PCR on a quantitative PCR system (Applied Biosystems 7500 Real-Time PCR System; Thermo Fisher Scientific, Waltham, MA, USA) under the following conditions: 95°C for 5 min followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. The relative expression levels of the target genes were normalized to that of the housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase. The expression levels of ST2, IL-33, CD16, CD32, CD86, CD206, iNOS, Arg1, IL-4, and TGF-β were calculated using the 2−∆∆CT method. The primer series are listed in Table 1.
TABLE 1 Primers for RT-PCR.
Genes
|
|
Primers (5’-3’)
|
ST2
|
Forward
Reverse
|
ATGATTGGCAAATGGAGAAT
TTCTAGACCCCAGGATGTTT
|
IL-33
|
Forward
Reverse
|
GTGCAGGAAAGGAAGACTCG
TGGCCTCACCATAAGAAAGG
|
CD16
|
Forward
Reverse
|
GCATGCTACTTACGGTTTCC
TGCGAGATGAGGCTTTTGT
|
CD32
|
Forward
Reverse
|
AGCTGCTGTCGCTGGAAT
GGATGCTTGAGAAGTGAATAGG
|
CD86
|
Forward
Reverse
|
TAGGGATAACCAGGCTCTAC
CGTGGGTGTCTTTTGCTGTA
|
CD206
|
Forward
Reverse
|
AGCTGCTGTCGCTGGAAT
GGATGCTTGAGAAGTGAATAGG
|
iNOS
|
Forward
Reverse
|
CAGCATCCACGCCAAGAA
CAACTCGCTCCAAGATCCCT
|
Arg1
|
Forward
Reverse
|
TGTGGGAAAAGCCAATGAAC
GGTGTCAGCGGAGTGTTG
|
IL-4
|
Forward
Reverse
|
ACAGGAGAAGGGACGCCAT
GAAGCCCTACAGACGAGCTCA
|
TGF-β
|
Forward
Reverse
|
AGGCGGTGCTCGCTTTGTA
ATTGCGTTGTTGCGGTCC
|
GAPDH
|
Forward
Reverse
|
GCAAGTTCAACGGCACAG
GCCAGTAGACTCCACGACAT
|
Statistical analysis
All data were analyzed using Prism software, version 8.4.2 (GraphPad, San Diego, CA, USA). We used Student's t-test to determine the statistical significance of the differences between SCI + vehicle, and SCI + riluzole. One-way analysis of variance and Tukey’s post hoc analysis were used to compare data between multiple groups. Two-way analysis of variance was used to analyze the difference in mRNA expression levels of IL-1β between SCI + vehicle and SCI + riluzole. Numerical data are shown as the mean ± SEM, and P < 0.05 was considered statistically significant.