Cell culture
HT-29 cell lines were purchased from the Pastor Institute (Iran). The cells were cultured in Dulbecco’s modified eagle medium (DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA), and penicillin/streptomycin (100 U/mL, 100 μg/mL) at 37°C and 5% CO2 in an incubator (Sina, Iran).
Fibrin gel preparation
To produce fibrin gel, 3 mg of fibrinogen (Sigma, USA) was gradually dissolved in 1 ml M199 medium (Sigma, USA), supplemented with 15% FBS, and added to a 24-well plate. Then, 30 µl of thrombin (Sigma, USA) with a concentration of 120 U/ml was added to each well. To form jelly texture, the plate was incubated at 37°C for 2 h.
Electron microscopy
HT-29 cells cultured in fibrin gel were washed by PBS and fixed with 2.5% glutaraldehyde for 2h. The samples were washed twice with PBS and dehydrated with ascending alcohol sequence (30, 50, 70, 80, 90, and 100%). Each sample was dried and covered using gold powder and imaging was performed by an electron microscope (SEM, LEO. 1455VP, Germany).
Cell viability
The colorectal adenocarcinoma HT-29 cells were cultured at 10×103 cells/well in a 96-well culture plate. The cells were then treated with concentrations of 50, 100, 200, and 500 µg/ml of GW9508 for 1, 3, and 5 days. Then, MTT solution (3-(4, 5-dimethylthiazol- 2-yl)-2, 5-diphenyl tetrazolium bromide in DMEM) was added to each well at a concentration of 0.5 mM, and the cells were incubated for 3 h at 37°C to form MTT tetrazolium crystals. Next, the MTT solution was removed, the crystals were dissolved with Dimethyl sulfoxide (DMSO) and their absorbance was measured at 570 nm by an ELISA reader (FAX STAT, USA).
Acridine orange/ethidium bromide (AO/EB) staining
HT-29 Cells were stained with acridine orange/ethidium bromide at a concentration of 100 µg/mL (1:1) for 5 min and observed using a fluorescence microscope (Olympus, Japan). In AO/EB stained cells, the live and apoptotic cells became green (510–530 nm) and red (650 nm) fluorescence, respectively. Briefly, the cells were cultured at a concentration of 50×103 cells/well fibrin gel in a 24-well culture plate and treated with IC50 concentration of GW9508 for 1 day. The cells were then washed by PBS and stained with AO/EB. The untreated cells were considered as a control group.
Monodansylcadaverine (MDC) staining for autolysosomes
HT-29 cells were cultured at a concentration of 50×103 cells/well fibrin gel in a 24-well culture plate and treated with IC50 concentration of GW9508 for 1 day. Then, the cells were stained with a 50 µM concentration of MDC (Sigma, USA) for 45 min at 37°C. The cells were then rinsed with PBS three times and observed using a fluorescence microscope (Olympus, Japan).
Real-time quantitative PCR
After treatments of HT-29 cells with IC50 concentration of GW9508 in a 6-well plate, RNA was extracted using RNX (Sinaclon, Iran), of which 300 ng was used to synthesize cDNA (Sinaclon, Iran). Markers mRNA level was measured by using RealQ Plus 2x Master Mix Green (ampliqon) and the sequence of the primes are including BAX (F) GCTGGACATTGGACTTCCTC, BAX (R) ACCACTGTGACCTGCTCCA, BAD (F) CGGAGGATGAGTGACGAGTT, BAD (R) CCACCAGGACTGGAAGACTC, BCL-2 (F) GATGGGATCGTTGCCTTATGC, BCL-2 (R) CCTTGGCATGAGATGCAGGA, P53 (F) GGAGGGGCGATAAATACC, P53 (R) AACTGTAACTCCTCAGGCAGGC, Beclin-1 (F) ATGGAGGGGTCTAAGGCG, Beclin-1 (R) TGGGCTGTGGTAAGTAATG, Atg5 (F) GGACCTTCTACACTGTCCATCC, Atg5 (R) TGTCATTCTGCAGTCCCATC, LC3 (F) GATAATCAGACGGCGCTTGC, LC3 (R) ACTTCGGAGATGGGAGTGGA, GAPDH (F) GCAAGAGCACAAGAGGAAGA, GAPDH (R) ACTGTGAGGAGGGGAGATTC. The cDNA was amplified in duplicate by qRT-PCR with the conditions: 95°C for 15 min, 40 cycles of (30 s at 95°C, 30 s at 48°C, and 30 s at 72°C) for 30 s, and 55°C for 30 s.
Western blotting
Protein isolation was carried out using RIPA lysis buffer. The protein concentration was measured by BCA Protein Assay Kit (Beyotime). Then, 10 µg of each sample was loaded on SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. The samples were blocked with 5% BSA in PBS containing 0.05% Tween-20. The membrane was incubated for 1.5 h at room temperature with anti p-AKT (1:500, Abcam), anti AKT (1:500, Abcam), anti p-mTOR (1:500, Abcam), anti mTOR (1:500, Abcam), anti AMPK (1:500, Abcam), anti P-AMPK (1:500, Abcam), and anti GAPDH (1:500, Abcam) followed by binding with an anti-rabbit secondary antibody anti-rabbit IgG-HRP (1:1000, Abcam). Ultimately, the bands were visualized by DAB solution (Sigma, Germany).
Superoxide dismutase activity assay
Superoxide dismutase (SOD) activity was assessed with a manual assay. The cell lysates from HT-29 cells in the treatment group (with IC50 concentration of GW9508) or control group (without treatment) were prepared and subjected to the assay following the Kono method[12]. This method was performed by measuring the inhibition of nitrotetrazolium reduction (NBT) in the presence of SOD at 560 nm. In this method, superoxide anion is produced due to the spontaneous oxidation of hydroxylamine. The combination of NBT with superoxide reacts to produce formazan red. The superoxide dismutase enzyme in the sample reacts with superoxide and converts to hydrogen peroxide while preventing the formation of red color.
Catalase activity assay
Cell lysates were prepared from HT-29 cells in the treatment group with IC50 concentration of GW9508 or control group (without treatment) and subjected to the assay following the Koroluk method[13]. The hydrogen peroxide per time was reduced owing to the activity of the enzyme catalase. Ammonium molybdate formed a yellowish complex with hydrogen peroxide. In this method, the samples were exposed to H2O2, and hydrogen was converted to water and oxygen by the enzyme in the sample. Residual hydrogen peroxide eventually produced a color compound with ammonium molybdate. The resulting color intensity was inversely related to the amount of enzyme activity.
Molecular docking
To predict the interaction of proteins involved in autophagy with GW9508, Molegro virtual docker (CLC Bio company, Aarhus, Denmark) was used along with g Molegro Virtual viewer V2.5 software. The 3D structures of proteins were recovered from the RCSB/PDB data bank and the 3D structure of ligand was retrieved from the Zinc database. The energy of EFL1 was recorded from the final output. To provide the proteins, we eliminated the metal ions, water molecules, solvent molecules, and fixed the side chain. Molecular docking was performed in Surflex-Dock Geom mode. The total scores were considered as a firm interaction when the value was more than 5.
Statistical analysis
The experiments were carried out in triplicate and the data were displayed as mean ± standard deviation (SD). The results were analyzed by one-way ANOVA. Also, P<0.05 was considered statistically significant. The data were managed by SPSS version 16.0.