Cell Lines
Cell lines were purchased from the European Collection of Cell Cultures (ECACC) (Porton Down, Salisbury, Wiltshire, UK) or generated at Brunel University London (Uxbridge, Middlesex, UK). Cisplatin resistant cell lines were created by continuous exposure of the wild-type cell line to increasing doses of the cis-Diamine-dichloro-platinum (cisplatin). Details of the cell lines are listed in Table 1.
Table 1
Details of the cell lines used in this study
Cell Line
|
Cell Type
|
Origin
|
IC50 cisplatin concentration
|
Cell Culture Medium Type
|
SK-OV-3
Wild-type
|
Human Caucasian ovary adenocarcinoma
|
European Collection of Authenticated cell lines, Public Health England (ECACC)
|
6 µg/ml
|
RPMI-1640
|
SK-OV-3R
|
Human Caucasian ovary adenocarcinoma
|
ECACC
|
23.50 µg/ml
|
RPMI-1640
|
PEA1
Wild-type
|
Human ovarian cancer; oestrogen receptor positive
|
ECACC
|
2 µg/ml
|
RPMI-1640
|
PEA1R
|
Human ovarian cancer; oestrogen receptor positive
|
ECACC
|
4.50 µg/ml
|
RPMI-1640
|
A2780
Wild-type
|
Human ovarian carcinoma
|
ECACC
|
4.5 µg/ml
|
RPMI-1640
|
*A2780R
|
Human ovarian carcinoma
|
ECACC
|
85.5 µg/ml
|
RPMI-1640
|
MRC5-SV1
Wild-type
|
Human foetal lung, SV40 transformed
|
ECACC
|
12 µg/ml
|
DMEM
|
MRC5-SV1R
|
Human foetal lung, SV40 transformed
|
ECACC
|
25 µg/ml
|
DMEM
|
NB1-hTERT
Wild-type
|
Human fibroblast, hTERT transformed
|
Brunel University London
|
13 µg/ml
|
DMEM
|
NB1-hTERTR
|
Human fibroblast, hTERT transformed
|
Brunel University London
|
23 µg/ml
|
DMEM
|
*Resistant to cisplatin when purchased from ECACC. |
Cell Culture
The cell lines were initially established in T25 or T75 cell culture flasks (Sarstedt, Leicester, UK) in RPMI 1640 or DMEM culture medium (Labtech International Ltd, East Sussex, UK) supplemented with 10% foetal bovine serum (Scientific Laboratory Supplies, Yorkshire, UK), 2.0 mM L-Glutamine (Labtech International Ltd), 100 Uml−1 Penicillin and 100 µgml−1 Streptomycin (Labtech International Ltd). Cells were routinely incubated at 37°C in a humidified atmosphere of 5% CO2 in air.
Cell number and viability were determined as required using a Countess™ automated cell counter based upon the method of trypan blue exclusion (Invitrogen, Renfrewshire, UK). Cell lines were used over a restricted range of ten passages, during which cell viability was not less than 90% for any experiment.
Resistance to either cisplatin in the resistant derivative cell lines was maintained by exposing the cells while growing as monolayers at approximately 80% confluence, to the relevant drug for one passage every three passages.
Exposure of Cells to Chemotherapeutic Drugs
Cisplatin solutions (Sigma Aldrich Ltd, Gillingham, Dorset, UK) were prepared initially in dimethyl sulfoxide (Fisher Scientific, Loughborough, Leicestershire, UK) and final concentrations of drug solutions were prepared initially in the appropriate serum-free cell culture medium for the cell lines (Labtech International Ltd). Cisplatin was then further diluted in the relevant complete medium to the required concentrations.
Clonogenic Assay after Exposure of Cells to Chemotherapeutic Drugs
Approximately 500 000 cells were seeded into 5 cm dishes in 5 ml complete medium and incubated overnight. Cells were exposed to the drug solutions for 1 hour, after which the cells were washed in phosphate-buffered saline (PBS) solution (pH 7.4) (Severn Biotech Ltd, Worcestershire, UK) and then trypsinised with trypsin/EDTA solution (200 mg/L Versene [EDTA] with 170 000 U trypsin/L) (Lonza Biologics PLC, Slough, Berkshire, UK) for approximately 10 minutes at 37˚C.
Cells were re-suspended in the appropriate complete medium, counted using a "Countess™" automated cell counter and seeded into three 10 cm tissue culture plates (Scientific Laboratory Supplies, Hessle, East Riding of Yorkshire, UK) for each drug dose. Seeding numbers of cells varied between 2000 and 6000 cells per plate, depending on the drug concentration used and the cell cloning efficiency of each cell line.
Following cisplatin treatment cells were trypsinised, counted and reseeded into 10 cm dishes and allowed to form colonies over a 2–3-week period, whereupon colonies formed were fixed in room temperature industrial methylated spirits (Tennants Distribution Ltd, Manchester, UK), stained with methylene blue stain (ReAgent, Cheshire, UK) and allowed to air-dry. Colonies of 50 cells or more were counted. The average number of colonies from the three plates for that drug dose was then calculated and survival was expressed as a percentage of colonies grown in untreated control dishes.
MTT Assay after Exposure of Cells to Chemotherapeutic Drugs
The A2780 wild-type and cisplatin resistance derivative did not form discrete colonies that were easy to count in an accurate manner following a clonogenic assay. To determine cell viability after cisplatin exposure MTT assay was conducted on these cell lines instead. Cells were plated out into 96-well microplates at a density of 25 000 cells in 100 µL per well and exposed to cisplatin for 1 hour, then incubated (incubation conditions described previously) for 48 hours. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) reagent (50 mg) (Merck-Millipore Ltd, Watford, UK) was dissolved in 10 ml PBS and sterilised by filtration. 10 µL of this solution was added to each well containing cell suspension, and the contents mixed by gentle agitation of the plate, followed by incubation for 3 hours (incubation conditions detailed previously).
Colour development was achieved by the addition of 10 µL propan-2-ol with 0.04 N HCl and well contents were mixed by retro-pipetting. A Biotek® Instruments Inc. ELx808™ absorbance microplate reader (Biotek® Instruments Inc., Vermont, USA) was used to obtain absorbance values of each well at a test wavelength of 562 nm and a reference wavelength of 630 nm.
Cell Fixation for Immunocytochemistry and Imaging Flow Cytometry after Cisplatin Exposure
After cisplatin treatment for 1 hour, cells were washed with PBS (Severn Biotech Ltd) and trypsinised into suspension as described earlier. Cells were then washed in ice-cold PBS, pelleted by centrifugation, fixed in ice-cold methanol/acetone mixture (50% v/v) (Fisher Scientific) and stored at −20°C until the immunocytochemistry stage.
Cells were fixed at 6, 12, 24-, 30-, 48- and 72-hours post-cisplatin exposure. The control samples (not treated with drug) were fixed at the 6 hour time-point, and the compensation samples were fixed at the 30 hour time-point.
Identification of MUS81 foci Exposure of Cells to Chemotherapeutic Drugs
Cells were washed once in ice-cold PBS (Severn Biotech Ltd) then incubated with gentle agitation for 5 minutes at room temperature in PBS, followed by incubation with gentle agitation for 5 minutes at room temperature in permeabilisation buffer consisting of 0.5% Triton™ X-100 (Sigma-Aldrich) in PBS. Cells were then incubated with gentle agitation for 1 hour at room temperature in blocking buffer consisting of 10.0% rabbit serum (Labtech International Ltd) with 0.1% Triton™ X-100 in PBS. The blocking buffer was removed, and the cells incubated with gentle agitation overnight at 4°C in primary antibody solution. The primary antibody solution consisted of an anti-MUS81 mouse monoclonal IgG2a antibody, clone MTA30 2G10/3 (Abcam, Cambridge, UK) diluted 1 in 1000 in blocking buffer. Primary antibody was removed by washing three times with wash buffer, consisting of 0.1% Triton™ X-100 in PBS. The secondary antibody solution consisted of an Alexa Fluor™488 rabbit anti-mouse IgG antibody (Invitrogen) diluted 1 in 1000 in blocking buffer. This was added to each sample, except the DRAQ5™ compensation samples, and incubated with gentle agitation for 1 hour at room temperature. During this incubation samples were protected from light by wrapping in aluminium foil. Secondary antibody was removed by washing three times with wash buffer. The cells were re-suspended in 100 µL Accumax™ solution (Global Cell Solutions, Virginia, USA) and left overnight at 4°C (no agitation). 1.0 µL of 5 mM DRAQ5™ solution (Biostatus Ltd, Leicestershire, UK) was added to each sample, except the AlexaFluor®488 compensation samples. The samples were submitted for analysis by imaging flow cytometry.
Imaging Flow Cytometry after Exposure of Cells to Chemotherapeutic Drugs
Imaging flow cytometry was undertaken using the ImagestreamX Mark II system equipped with INSPIRE™ data acquisition software (Luminex Instruments, Thermofisher Ltd, UK) as previously described23 − 24.
Image Compensation
Image compensation is described in detail previously23-24. In brief, it was performed on the cell populations fixed 30 hours post-drug exposure where MUS81 protein expression, and hence staining intensity, was highest. Images of cells stained with either antibody or DRAQ5™ were collected with the 488 nm laser only and were used to generate the compensation matrix. The software compensation wizard generated a table of coefficients whereby detected light displayed by each image was placed into the proper channel (channel 2 for antibody staining and channel 5 for DRAQ5) on a pixel-by-pixel basis. The coefficients were normalised to 1 and each coefficient represented the leakage of fluorescent signal into juxtaposed channels. Calculated compensation values were applied to all subsequent analyses as appropriate.
Analysis of Cell Images - Calculation of Foci Number
Foci indicating the presence of the MUS81 protein were quantified in approximately 10,000 (1000 for the compensation samples) images of cells per time point captured using the INSPIRE™ imaging flow cytometry software. Foci were quantified in a similar manner as described previously24, with the spot counting wizard in the IDEAS™ software permitting simplified foci quantitation. The wizard consists of sequential steps that identified all captured images of single cells that were in optical focus. Next, images of fifty cells from this population with varying numbers of clearly defined foci were selected to create a truth population. Images from the truth population were used to produce a mask that identified only those foci located within the cell nuclei of each image. The finalised truth population was then saved as a template and applied to quantitate foci present in all acquired cell images.
Exposure of Cells to Chemotherapeutic Drugs and Cell Fixation for Quantitative Real-time PCR Analysis
Approximately 1 × 106 cells were seeded into 10 cm dishes in 10 ml complete medium and incubated overnight (incubation conditions described earlier). Cells were exposed to cisplatin for 1 hour, after which the cells were trypsinised and counted as previously described. Cell pellets of approximately 1 × 106 – 5 × 106 cells were snap-frozen by exposure to liquid nitrogen for 5 minutes and stored at −80°C. Cells were frozen at 24-, 30- and 72-hours post-drug exposure. The control samples (not treated with drug) were fixed at the 24-hour time-point.
RNA Extraction from the Cells Fixed for Quantitative Real-time PCR Analysis
RNA was extracted from the frozen cell pellets using a GenElute™ Mammalian Total RNA Miniprep Kit and On-Column DNase I Digestion Set (Sigma-Aldrich), as per the manufacturer’s instructions. In brief, cells were lysed, and RNase inactivated with the application of 250 µL lysis buffer/2-mercaptoethanol solution. Cell debris was removed by passing the lysed cells through a filtration column, and the resulting lysate was diluted 1:1 (v:v) with 70% ethanol (Fisher Scientific) in diethyl pyrocarbonate (DEPC)-treated water (Sigma-Aldrich). The diluted lysate was passed through a nucleic acid binding column and the bound RNA and DNA washed withproprietary wash buffer. Any DNA present on the column was degraded with DNase treatment, and the column washed three times with proprietary wash buffers. The RNA was eluted from the column and the resulting solution containing RNA stored on ice.
Verification of RNA Quality using Spectrophotometry & Agarose Gel Electrophoresis (qPCR)
The quality and quantity of the RNA was measured using a NanoDrop™ 2000c spectrophotometer (ThermoFisher Scientific, Hemel Hempstead, Hertfordshire, UK). Quality was determined using the 260/280 value, and quantity was measured in nanograms/microlitre.
The integrity of the RNA was verified by gel electrophoresis using a 2% agarose gel.
Production of cDNA from RNA (q-PCR)
All the following reagents were supplied by Invitrogen: random hexamer primers; dNTP mix; first strand buffer; DTT; SuperScript® III reverse transcriptase. DEPC-treated water was supplied by Sigma-Aldrich and RNase Away® reagent by Life Technologies.
The RNA solutions were diluted with DEPC-treated water so that the reaction mixture contained at least 1 µg RNA. The reaction mixture for each RNA sample consisted of the following: 5 µl RNA solution containing at least 1 µg RNA; 1 µl random primers; 1 µl 10 mM dNTP mix; 6 µl DEPC-treated water. This mixture was incubated at 70°C for 10 minutes and the following reagents added to each sample: 4 µl first strand buffer; 2 µl 0.1 M DTT; 0.5 µl RNase Away® solution; 0.5 µl 100 U SuperScript® III reverse transcriptase enzyme; 1 µl DEPC-treated water. The mixture was incubated at the following temperatures and times: 42°C for 50 minutes, then 70°C for 15 minutes, then 25°C for 5 minutes. cDNA concentration was determined using the NanoDrop™ 2000c spectrophotometer and the cDNA stored at −80°C.
Verification of cDNA Quality (q-PCR)
The quality of the cDNA was verified by PCR followed by agarose gel electrophoresis. The reagents used were: ReadyMix™ REDTaq® PCR reaction mix with MgCl2 (Sigma-Aldrich); nuclease-free water (ThermoFisher Scientific); primer pair for the GAPDH gene at 5 µM concentration with the following base sequences: forward primer GAAGGTGAAGGTCGGAGTC; reverse primer GAAGATGGTGATGGGATTTC (Sigma-Aldrich). The integrity of the PCR products (and hence the quality of the cDNA) was verified by gel electrophoresis using a 2% agarose gel.
Determination of the Optimum Housekeeping gene for qPCR using the geNorm™ Kit
Two reference genes were identified using the geNorm™ Human Reference 12-Gene Selection Kit (Primerdesign Ltd, Eastleigh, Hampshire, UK) as per the manufacturer’s instructions. The kit included primer sets for the following reference genes: TOP1; YWHAZ; EIF4A2; RPL13A; SDHA; ACTB; 18s; GAPDH; UBC; ATP5B; B2M; CYC1. Additional reagents used were: Fast SYBR® Green Master Mix (Applied Biosystems/Thermo Fisher Scientific); nuclease-free water (Severn Biotech Ltd); DEPC-treated water (Sigma-Aldrich). In brief, cDNA samples from cell lines SK-OV-3 (wild-type), cisplatin resistant SK-OV-3R, wild-type MRC-5-SV1 and cisplatin resistant MRC-5 SV1R were volumetrically adjusted with DEPC-treated water such that each had a concentration in the range 5 ng/µl - 10 ng/µl in a volume of at least 132 µl. A reaction mixture was created using the following: 1 µl proprietary primer mix; 10 µl Fast SYBR® Green Master Mix; 4 µlproprietary RNase/DNase-free water. This mixture was added to one well of a 96-well plate (Applied Biosystems/Thermo Fisher Scientific) and 5 µl of the diluted cDNA solution added. RNase/DNase-free water was used in place of cDNA solution for the control samples. The samples were prepared in triplicate and submitted for amplification to a QuantStudio 7 Flex real-time PCR instrument (Applied Biosystems/Thermo Fisher Scientific) using 40 cycles of the following conditions: enzyme activation (2 minutes at 95°C), then denaturation (5 seconds at 95°C), then data collection (20 seconds at 60°C) followed by a melt curve stage.
The resulting data was analysed with the qbasePLUS software, which gave the average expression stability value for each reference gene. The two most stable reference genes with the least variation between cDNA samples were found to be YWHAZ and SDHA. Therefore, these two genes were used as internal reference standards for all subsequent q-PCR analyses.
Establishing the Percentage Efficiency of the MUS81, YWHAZ & SDHA Primers (QPCR)
The percentage efficiency of the MUS81, YWHAZ and SDHA primer pairs from the geNorm™ Human Reference 12-Gene Selection Kit (details as above) was determined as follows. The reagents used were; primers for the MUS81 gene at 5 µM concentration with the following base sequences: forward primer ACGCAGGAGCCATCAAGA; reverse primer TGGCAGGGGTGCTGTATC (Sigma-Aldrich); primers for the YWHAZ and SDHA genes at 6 µM (sequences not supplied by manufacturer); Fast SYBR® Green Master Mix (details as above); nuclease-free water (details as above); cDNA sample made previously from the SK-OV-3 cell line (concentration 475.4 ng/µl). The cDNA sample was diluted with nuclease-free water to yield cDNA concentrations within the PCR reaction samples of 10 ng/µl; 25 ng/µl; 50 ng/µl; 75 ng/µl; 100 ng/µl and 125 ng/µl. The reagents were combined in the following quantities to amplify one cDNA sample: 10 µl Fast SYBR® Green Master Mix; 8 µl nuclease-free water; 0.5 µl each of the MUS81 forward and reverse primer solutions or 1 µl (6 µM primer concentration) of the YWHAZ/SDHA primer solutions; 1 µl cDNA solution or nuclease-free water (control samples). Samples were prepared in triplicate in 96-well plates (as before) and PCR amplification performed using a qbasePLUS Flex Real-Time PCR instrument using 40 cycles of the following conditions: enzyme activation (2 minutes at 95°C), then denaturation (5 seconds at 95°C), then data collection (20 seconds at 60°C). The resulting data was analysed using the qbasePLUS Real-Time PCR software. This permitted the creation of standard curves for each primer pair where the mass of cDNA was plotted against the corresponding CT value. The resultant slope of each graph approximated to a value of −3 and the R2 value approximated to 1. From this the percentage efficiency values for each primer pair were calculated as follows: MUS81 89.38%; YWHAZ 104.91%; SDHA 95.66%. To conclude: the percentage efficiency values were sufficiently close to one another and approximate to 100% to permit the use of the primers in the QPCR method.
Determination of MUS81 Gene Expression using Reference Genes YWHAZ & SDHA (QPCR)
The expression of the MUS81 gene in each cell line was performed using the cDNA of each cell line (preparation details as above). The reagents used were: primers for the MUS81, YWHAZ and SDHA genes (details in the previous section); Fast SYBR® Green Master Mix (details in the previous section); nuclease-free water (details in the previous section). cDNA samples were diluted with nuclease-free water such that each sample had a concentration range of 5 ng/µl to 10 ng/µl with a tolerance of 2 ng/µl between samples. The reagents were combined in the following quantities to amplify one cDNA sample: 10 µl Fast SYBR® Green Master Mix; 4 µl nuclease-free water; 0.5 µl each of the MUS81 forward and reverse primer solutions or 1 µl of the YWHAZ/SDHA primer solutions; 5 µl cDNA solution or nuclease-free water (control samples). Samples were prepared in triplicate in 96-well plates and amplification performed as described previously. The resulting data was analysed using the qbasePLUS Real-Time PCR software, where the Relative Quantification (RQ) value was calculated for each sample.
Optimisation of Cell Density in 96-well Plates (siRNA Knockdown)
To determine optimum cell density, cells from cell lines SK-OV-3R and MRC-5 SV1R were established in duplicate in 96-well plates in the following concentrations (number of cells/well in 100 µl cell suspension): 10 000; 15 000; 20 000; 25 000; 30 000; 35 000 and the percentage confluence was estimated each day over a five-day period. It was concluded that the optimum cell number/well of a 96-well plate were 10 000 (for cell line SK-OV-3R) and 25 000 (for cell line MRC-5 SV1R).
Determination of Transfection Efficiency using 96-well Plates (siRNA Knockdown)
The transfection efficiency of siRNA in the wild-type SK-OV-3, cisplatin resistant SK-OV-3R, wild-type MRC-5 SV1 and MRC-5 SV1R cell lines was established as follows with all reagents supplied by Dharmacon/GE Healthcare, Amersham, Buckinghamshire, UK. The optimum number of cells for each cell line (established previously) was seeded into each well of a 96-well plate and cultured under conditions described previously for 24 hours, the complete medium removed, and the cells washed once with 100 µl of either additive-free RPMI-1640 cell culture medium (SK-OV-3 cell lines) or DMEM cell culture medium (MRC-5 SV1 cell lines). The 5× siRNA buffer was diluted to a 1× siRNA buffer with the addition of RNase-free water. The siGLO™ Green Transfection Indicator siRNA 100 µM stock solution was diluted with the 1× siRNA buffer to create a 5 µM solution, and further diluted with the appropriate additive-free cell culture medium such that the cells/well would be exposed to 0.5 µl in a total volume of 10 µl. The transfection reagent was diluted with the appropriate additive-free cell culture medium such that the cells/well would be subjected to: no transfection reagent (control samples); 0.05 µl; 0.28 µl or 0.5 µl volumes of the transfection reagent in a total volume of 10 µl. The 10 µl diluted siGLO™ Green Transfection Indicator siRNA solution and the 10 µl diluted transfection reagent solution for each well of cells were mixed and incubated at room temperature for 20 minutes, before being transferred to the appropriate sample on the 96-well plate. The samples were routinely incubated for either 22 hours or 46 hours, then the transfection efficiency estimated using a FLoid Cell Imaging Station (Life Technologies). It was found that the optimum transfection efficiency was achieved using a volume of 0.28 µl transfection reagent/sample which resulted in an at least 80% transfection rate for the cell lines.
Reduction of MUS81 Gene Expression using the siRNA Knockdown Technique
Wild-type SK-OV-3, cisplatin resistant SK-OV-3R, wild-type MRC-5 SV1 and cisplatin resistant MRC-5 SV1R cells were plated out into 6-well plates at optimum densities (established previously).
The transfection reagents (all supplied by Dharmacon) were prepared as follows. The 5× siRNA buffer was diluted to a 1× siRNA buffer with the addition of RNase-free water. The ON-TARGETplus™ SMARTpool Human MUS81 and ON-TARGETplus™ Control Pool non-targeting siRNA 100 µM stock solutions were diluted with the 1× siRNA buffer to create 5 µM solutions, then further diluted (10 µl 5 µM siRNA solution + 190 µl additive-free cell culture medium per plate well of cells). The transfection reagent was diluted (5.6 µl transfection reagent + 194.4 µl additive-free cell culture medium per plate well of cells). The diluted siRNA was combined with the diluted transfection reagent and 1600 µl of the appropriate antibiotic-free complete medium and incubated at room temperature for 20 minutes.
The antibiotic-free complete medium was removed from the cells by aspiration and the siRNA/transfection reagent/antibiotic-free complete medium solution added. The cells were incubated (conditions described previously) for 3 days if a single knockdown was being performed, before being processed for either MUS81 protein expression or for a clonogenic assay. A double knockdown was achieved by incubating the cells for 2 days in the first batch of siRNA/transfection reagent/antibiotic-free complete medium solution, then removing and replenishing it with a fresh batch of siRNA/transfection reagent/antibiotic-free complete medium solution, before processing the cells for either MUS81 protein expression or for a clonogenic assay after a further 2 days incubation.
Determination of MUS81 mRNA and Protein Expression Post (Double) siRNA Knockdown after Cisplatin Exposure using qPCR and/or Imaging Flow Cytometry
The aim of these experiments was to determine the MUS81 expression using either qPCR or imaging flow cytometry on cells that had undergone a double knockdown event before being exposed to cisplatin for 1 hour. In both cases, the cells underwent the double knockdown of the MUS81 gene (method described above). Two days after the addition of the second batch of siRNA/transfection reagent/antibiotic-free complete medium solution, the cells were incubated for 1 hour in 312 µg/ml cisplatin. Cisplatin-containing medium was removed and replaced with the appropriate complete medium, the cells were incubated for 24 or 48 hours before being fixed for either qPCR or imaging flow cytometry to determine MUS81 foci number (MUS81 protein expression).
Determination of Cell Survival using Clonogenic Assays Post (Double) siRNA Knockdown of MUS81 Gene with Cisplatin Exposure
The aim of these experiments was to determine cell survival using a clonogenic assay on cells that had undergone a double knockdown event before being exposed to cisplatin for 1 hour. Cells were plated out for the clonogenic assay (as described above) 24 hours after being exposed to 12 µg/ml cisplatin for 1 hour, at a density of 2000 cells/10 cm plate. The cells were incubated for two or three weeks, before being fixed, stained and counted as described above.