Detection of Streptococcus Pneumoniae and elimination of carryover contamination by multiple cross displacement amplification coupled with antarctic thermal sensitive uracil-DNA-glycosylase

doi:10.21203/rs.2.9259/v2

Download PDF

Research article

Detection of Streptococcus Pneumoniae and elimination of carryover contamination by multiple cross displacement amplification coupled with antarctic thermal sensitive uracil-DNA-glycosylase

https://doi.org/10.21203/rs.2.9259/v2

This work is licensed under a CC BY 4.0 License

Version 2

posted

You are reading this latest preprint version

Background: Streptococcus pneumoniae is an important clinical pathogenic bacterium, which is the primary cause of meningitis, septicemia and community-acquired pneumonia. The mortality rate of pneumococcal disease was high, especially in children under 5 years of age. Rapid and accurate detection of S. pneumoniae is critical. Methods: A ply gene-based multiple cross displacement amplification (MCDA), which amplifies DNA under isothermal conditions (65 °C) for 40 min, was established for accurate and rapid detection of S. pneumoniae. Antarctic thermal sensitive uracil-DNA-glycosylase (AUDG) was applied for eliminating carryover contamination. Lateral flow biosensor (LFB) was used to indicate the amplification results. Results: The ply-MCDA assay can detect as little as 10 fg of S. pneumoniae DNA, as well as 447 CFU/mL of spiked sputum samples. The sensitivity of ply-MCDA assay in clinical samples was 100 times that of PCR. The specificity of MCDA primer targeting the ply gene was validated using 15 S. pneumoniae and 25 non-S. pneumoniae, suggesting that ply gene-based MCDA assay was highly selective for S. pneumoniae. Moreover, the ply-MCDA coupled with AUDG can effectively eliminate carryover contamination, and then prevent false-positive results. Conclusion: The ply-MCDA assay coupled with AUDG was a simple, rapid and accurate method in the diagnosis of S. pneumoniae infection.

Internal Medicine Specialties

Streptococcus pneumoniae

Multiple cross displacement amplification

Lateral flow biosensor

Antarctic thermal sensitive uracil-DNA glycosylase (AUDG)

False-positive result

Streptococcus pneumoniae is a gram-positive bacterium and regularly colonizes in the upper respiratory tract, which is the most common pathogen of human meningitis, septicemia, community-acquired pneumonia, otitis media and sinusitis [1, 2]. According to the 2005 data of World Health Organization (WHO), S. pneumoniae infection causes 1.6 million deaths worldwide yearly, of which 700,000 to 1 million are children under 5 years of age, and mostly from developing countries[3]. Thus, rapid and accurate detection of S. pneumoniae is a primary task in preventing the spread of this pathogen and reducing the risk of pneumococcal disease.

The traditional detection technique for S. pneumoniae is bacterial culture-colonial morphology-biochemical examination, which is time-consuming, usually requiring three or more days. Rapid and accurate detection of S. pneumoniae is essential for clinical treatment. Polymerase chain reaction (PCR)-based molecular biology techniques have been used for S. pneumoniae detection through primers specific to ply gene [4-6]. Pneumolysin, which is encoded by the ply gene, is a virulence factor from S. pneumoniae and involved in the pathogenesis [7, 8], representing the potential diagnostic target. However, the PCR reaction system is complex, complicated to perform, and requiring expensive thermal cycle apparatus and professional technicians[9]. Thus, PCR-based assay is not available in some backward clinical laboratories and “on-site” detection.

In recent years, a novel isothermal amplification method of DNA, multiple cross displacement amplification (MCDA), was devised by Wang et al. [10]. Compared with PCR, MCDA has superior performance, which amplifies DNA under isothermal temperature (60°C-69°C) with higher efficiency, specificity and only a simple thermostatic equipment is required. This method has been used for detecting Klebsiella pneumoniae [11], Vibrio parahaemolyticus [12], Listeria monocytogenes [13] and so on. The MCDA reaction system requires ten primers that specially recognize ten different regions of the target gene, and it can be completed within 40 min. Therefore, MCDA assay might be a valuable method for rapid and accurate detection of S. pneumoniae, especially when resource settings are limited. In addition, four detection methods of MCDA products, including colorimetric indicator, real-time turbidity, lateral flow biosensor (LFB) and gel electrophoresis have been adopted[14] .

In present study, MCDA assay was established for rapid and accurate detection of S. pneumoniae. Ply gene, S. pneumoniae-specific gene that encodes pneumolysin, was used as the target gene. We evaluated the detection performance of ply-MCDA assay for S. pneumoniae. Furthermore, antarctic thermal sensitive uracil-DNA glycosylase (AUDG) was applied for the ply-MCDA reaction system to eliminate carryover contamination.

Primer design

Pneumolysin, a virulence factor, encoded by the ply gene, is a specific target for S. Pneumoniae detection. Ten primers were designed targeting the ply gene of S. pneumoniae according to the primer design principle of MCDA [13]. Primer Primer 5.0 and PrimerExploer V4 were used. The pneumolysin (ply)-encoding primer sets are listed in Table 3 and Figure 5. Blast analysis was performed to confirm the specificity of primer sets designed for S. pneumoniae. The 5'-ends of C1 was labeled with fluorescein isothiocyanate (FITC). The 5'-ends of D1 was labeled with biotin. Primers synthesis was done in Aoke Dingsheng Biotechnology Co., Ltd. (Beijing, China).

Bacteria strains

In this study, 15 S. pneumoniae and 25 non-S. pneumoniae were used (Table 1). The QIAamp DNA mini Kit (Hilden, Germany) was used for the extraction of genomic DNA from bacteria strains. Protocols were carried out according to the manufacturer’s instructions. The S. pneumoniae ATCC49619 was used for performance confirmation, optimal temperature determination and sensitivity analysis. Serial dilutions of S. pneumoniae ATCC49619 DNA (10ng, 10pg, 1pg, 100fg, 10fg, 1fg and 0.1fg/μL) were used to analyze the sensitivity of ply-MCDA assay.

S. pneumoniae ply-MCDA assay

The S. pneumoniae ply-MCDA assay was conducted referring to previously published methods of Wang et al. [13]. Isothermal amplification kits (Haitaizhengyuan, Beijing, China) was used for MCDA assay. S. pneumoniae ply-MCDA assay was performed in a 25μl reaction system, including 12.5μl of 2×Reaction buffer, 0.4μM of F1 and F2,1.6μM of CP1 and CP2, 0.8μM of C1 (C1*), R1, D1 (D1*), C2, R2 and D2, 1μl of Bst DNA polymerase (10U), and 1 μL of DNA template. Distilled water was blank control, and Staphylococcus aureus DNA and Salmonella typhi DNA were negative controls. The reactions were isothermal amplified at 65°C 40 min, then 85 °C 5 min to stop the amplification.

In this study, four methods including colorimetric indicator (Malachite Green, MG), turbidimeter (Loopamp Realtime Turbidimeter LA-320C), lateral flow biosensor (LFB) and 2% agarose gel electrophoresis were used to detect the amplification results. The above four methods were performed as previously described [14].

Optimal temperature of ply-MCDA assay

The optimal temperature of S. pneumoniae ply-MCDA assay was measured at an isothermal temperature in the range of 62°C to 67°C at intervals of 1 °C. Distilled water was blank control. Staphylococcus aureus DNA and Salmonella typhi DNA were negative controls. The temperature that contributed to produce higher amplification products and occur turbidity earlier was considered for the optimal amplification temperature. This experiment repeated three times.

Sensitivity of ply-MCDA assay

Sensitivity of ply-MCDA assay was determined using serial dilutions of S. pneumoniae ATCC49619 DNA. A total of 7 different concentrations of DNA templates (10ng, 10pg, 1pg, 100fg, 10fg, 1fg, 0.1fg/μL) were acquired. 1 μL of dilution was adding to the mixture system and then amplified at optimal temperature for 40min. Colorimetric indicator, real-time turbidity, LFB detection and gel electrophoresis were carried out to analyze the ply-MCDA products and then determine the detection limit of S. pneumoniae ply-MCDA assay. Distilled water was blank control. The sensitivity experiment repeated in triplicate.

AUDG enzyme eliminates carryover contamination.

The S. pneumoniae ply-MCDA products without AUDG enzyme digestion were quantified and subsequently diluted in the range of 1×10−10 g/μL to 1×10−20 g/μL. These dilutions were used as simulated carryover contamination and served as templates in the S. pneumoniae ply-MCDA assay. To demonstrate that the simulated carryover contamination (UTP-incorporated ply-MCDA products) can contaminate the ply-MCDA reaction and confirm that AUDG enzyme can eliminate the carryover contamination, the sensitivity of ply-MCDA-AUDG and ply-MCDA were compared by using the above serial diluted S. pneumoniae ply-MCDA products (1 μL). The ultraviolet spectrophotometer (NanoDrop ND-1000, Calibre, China) was used for quantification.

Specificity of ply-MCDA assay

To determine the specificity of S. pneumoniae ply-MCDA assay, genomic DNA from 40 bacteria strains including 15 S. pneumoniae and 25 non-S. pneumoniae were used for ply-MCDA assay (Table 1). The ply-MCDA products were analyzed using colorimetric indicator and LFB. The specificity experiment repeated three times.

Clinical sensitivity of ply-MCDA assay

The clinical sensitivity of S. pneumoniae ply-MCDA assay was evaluated by artificially adding different amounts of colony forming units (CFU) of S. pneumoniae ATCC49619 to the sputum samples. The single colony of ATCC49619 was enriched and cultured. Then, the number of ATCC49619 CFUs was counted and the culture suspension was added to S. pneumoniae negative sputum samples. The concentration of ATCC49619 in the sputum samples was adjusted to 4.47×100, 4.47×101, 4.47×102, 4.47×103, 4.47×104, 4.47×105, 4.47×106 CFU/mL. 100 μL of each spiked sputum sample was taken for genomic DNA extraction and then eluted in 10 μL of elution buffer (Qiagen, Germany). Next, 1 μL of DNA template was used for ply-MCDA assay and PCR method was also adopted. The experiment was performed three times independently.

Confirmation of ply-MCDA products.

To confirm the feasibility of the ply gene-targeted MCDA assay in detecting S. pneumoniae, ply-MCDA assay with and without target DNA were conducted at 65 º C for 40 min. The ply-MCDA products of S. pneumoniae ATCC49619 was visually detected as lake green color in the tube (Fig.1A), two red lines (control line and test line) on the LFB (Fig.1B) and ladder-like bands on the gel (Fig.1C), which indicated the amplification with target sequence. While the ply-MCDA products of negative controls and blank control were present as colorless (Fig.1A), one red line (control line) (Fig.1B) and non-ladder bands (Fig.1C). Our results suggested that S. pneumoniae-specific primers targeting the ply gene were suitable for MCDA assay.

Optimal temperature of ply-MCDA assay.

To measure the optimal temperature of the ply-MCDA assay, the DNA of S. pneumoniae ATCC49619 (1 pg/reaction) was amplified at intervals of 1 °C in the range of 62°C to 67°C, respectively. The real-time turbidity of different temperatures was monitored. From the Kinetic curves as shown in Figure 2, we found that the optimal amplification temperature was 65°C because the reaction turbidity occurred earlier and the amount of ply-MCDA products were higher than other temperatures (Fig. 2D). 65°C was used in subsequent studies.

Sensitivity of ply-MCDA assay.

To identify the detection limit, serial dilutions of S. pneumoniae ATCC49619 DNA (10ng, 10pg, 1pg, 100fg, 10fg, 1fg, 0.1fg/μL) were subjected to be amplified at 65°C. Our results indicated that the detection limit of S. pneumoniae ply-MCDA assay was 10fg (Fig.3). The positive amplicons were represented in the color indicator (Fig.3A), real-time turbidity (Fig.3B), LFB (Fig.3C) and gel electrophoresis (Fig.3D) as lake green color, turbidity curve, two red lines and ladder-like bands, respectively. Moreover, the results of the above four methods were completely consistent.

AUDG enzyme eliminates carryover contamination.

To determine whether the carryover contamination from the UTP-incorporated ply-MCDA products would contaminate the ply-MCDA reaction, the sensitivity of ply-MCDA-AUDG and ply-MCDA were evaluated by using serial dilutions of ply-MCDA products (between 1×10−10 g/μL and 1×10−20 g/μL). Our results showed that ply-MCDA-AUDG could detect simulated carryover contamination of 1×10−14 g/μL or more (Fig.4). However, ply-MCDA without AUDG enzyme could detect simulated carryover contamination of 1×10−19 g/μL (Fig.4). These results indicated that false positive results would occur when the concentration of carryover contamination reach 1×10−19 g/μL. In addition, the results demonstrated that the AUDG enzyme is able to eliminate the carryover contamination. Therefore, the possibility of false positive results can be significantly reduced by adding AUDG enzyme to the ply-MCDA system.

Specificity of ply-MCDA assay.

To identify the specificity of ply-MCDA assay with AUDG digestion in detecting S. pneumoniae, DNA from 15 S. pneumoniae and 25 non-S. pneumoniae were tested. The 15 strains of S. pneumoniae showed positive results, while other Streptococcus species and non-Streptococcus strains showed negative results (Table 1). The results suggested that ply-MCDA-AUDG assay was highly specific for S. pneumoniae.

Clinical sensitivity of ply-MCDA assay.

To determine the sensitivity of ply-MCDA assay with AUDG digestion in clinical samples, sputum samples artificially contaminated with serial dilutions of S. pneumoniae ATCC49619 were tested. Positive amplification occurred when the amount of S. pneumoniae ATCC49619 in the sputum samples reach 447 CFU/ml (equivalent to 4.47 CFU per reaction) (Table 2). Moreover, the sensitivity of ply-MCDA-AUDG assay was 100 times that of PCR, the detection limit of PCR was 44700 CFU/ml (equivalent to 447 CFU per reaction) (Table 2).

S. pneumoniae, an important human pathogenic bacterium, causes high morbidity and mortality. Statistics show that in China, the cases of pneumococcal infection account for 12% of the global cases, which is also one of the countries with the highest deaths caused by pneumococcal infection in children under 5 years old [15]. Because of the severity of S. pneumoniae infection, simple and accurate methods are needed to detect S. pneumoniae and timely guide clinical treatment. Mitsuko et al. has reported a rapid method, loop-mediated isothermal amplification (LAMP), applying for detection of S. pneumoniae infection, which is highly selective due to its recognition of six different regions of the target gene by four primers [16, 17]. Studies have reported that increasing the primers of isothermal amplification could improve the sensitivity [18]. This study developed a novel method, MCDA in combination with AUDG, to specifically detect S. pneumoniae and prevent false positive results.

Within the present study, we designed five pairs of primers targeting ten distinct regions of the ply gene. Ply gene, which encodes pneumolysin, a well-characterized virulence factor of S. pneumoniae and participating in the pathogenesis, has been used as the specific target gene of S. pneumoniae [7, 8] . Our results demonstrated that the primer sets are highly specific for S. pneumoniae. All of the strains of S. pneumoniae were positively amplified, while the other Streptococcus species and non-Streptococcus strains were not amplified (Table 1). Therefore, the specificity of ply-MCDA assay in the diagnosis of S. pneumoniae infection was extremely high, especially combining with clinical manifestations.

In addition, we determined the sensitivity of ply-MCDA assay by testing serial dilutions of S. pneumoniae ATCC49619 DNA. The detection limit of ply-MCDA assay was 10fg (Fig.3). It has been reported that LAMP can detect S. pneumoniae as few as 25 fg [19] or 20 fg [20]. We also assessed the clinical sensitivity of this assay by using spiked sputum samples. The ply-MCDA assay can detect S. pneumoniae as low as 447 CFU/ml (equivalent to 4.47 CFU per reaction), which is similar to that of LAMP [19]. Thus, ply-MCDA assay was a sensitive method for S. pneumoniae detection.

However, owing to the high sensitivity of ply-MCDA assay, false positive results caused by carryover contamination became a barrier to rapid and accurate detection of S. pneumoniae. Moreover, aerosols that containing high concentrations of products cannot be avoided because the opening indicating operations of ply-MCDA products (such as LFB). The results of this study suggested that trace amounts of carryover contamination (1×10−19 g/μL) can lead to false positive results. Thus, AUDG enzyme digestion was performed to prevent the false positive results caused by carryover contamination, which specifically cleave uracil bases and permit nature templates to be amplified normally [11, 19], and which can eliminate up to 1×10−15 g/μL of simulated contaminants. These results suggested that ply-MCDA-AUDG assay can effectively eliminate carryover contamination and then reduce false positive results.

About results analysis, colorimetric indicator, real-time turbidity, LFB and gel electrophoresis were used. Our results showed that these four methods were highly consistent. However, comparing with conventional analysis methods, LFB was probably the optimal monitoring method. In the MCDA system, one primer was labeled with FITC and one primer was labeled with biotin. Subsequently, positive amplicons are simultaneously labeled with FITC and biotin. In LFB, FITC and biotin labeled products combined with dye streptavidin coated on the control line and anti-FITC antibodies immobilized on the test line, respectively. The results are displayed as two red lines within 2 minutes. The advantages of LFB included simple, rapid, cost-effective, objective, and no equipment requirement. Thus, LFB is an effective method for analysis of MCDA products.

In summary, we established a simple, rapid and accurate ply-MCDA-LFB method in combination with AUDG for the diagnosis of S. pneumoniae and eliminating carryover contamination. LFB provided a potential tool for rapid and accurate detection of S. pneumoniae. The sensitivity, specificity and clinical sensitivity of ply-MCDA assay in the diagnosis of S. pneumoniae were successfully evaluated using cultured strains and sputum samples. Therefore, the ply-MCDA-LFB method coupled with AUDG is potentially a valuable tool for the detection of S. pneumoniae.

AUDG: Antarctic thermal sensitive uracil-DNA glycosylase

CFU: colony forming unit

FITC: fluorescein isothiocyanate

LAMP: loop-mediated isothermal amplification

LFB: lateral flow biosensor

MCDA: multiple cross displacement amplification

MG: Malachite Green

PCR: polymerase chain reaction

Ply: pneumolysin

WHO: World Health Organization

Acknowledgments

Not applicable

Funding

This research was supported by the Beijing Natural Science Foundation [Grant no. 7192240], National Natural Science Foundation of China [Grant no. 81760376], and Peking University Shougang Hospital [Grant no. 2017-Yuan-LC-08, SGYYZ201701].

Availability of data and materials

The datasets used during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

SH designed the study. LY, FZ and LN carried out the experiments and data analysis, and manuscript writing. YC, LW, XZ, YW and JN participated in the acquisition of materials. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

This study was carried out in accordance with the Declaration of Helsinki. This study was approved by the Ethics Committee of Peking University Shougang Hospital. All subjects gave written informed consent.

Consent for publication

Not applicable

Competing interests

The authors declare that they have no competing interests.

1. Brown PD, Lerner SA. Community-acquired pneumonia. Lancet. 1998; 352:1295-302.

2. Yao KH, Yang YH. Streptococcus pneumoniae diseases in Chinese children: past, present and future. Vaccine. 2008; 26:4425-33.

3. Organization WH. Pneumococcal conjugate vaccine for childhood immunization--WHO position paper. Wkly Epidemiol Rec. 2007; 82:93-104.

4. Rudolph KM, Parkinson AJ, Black CM, Mayer LW. Evaluation of polymerase chain reaction for diagnosis of pneumococcal pneumonia. J Clin Microbiol. 1993; 31:2661-6.

5. Salo P, Ortqvist A, Leinonen M. Diagnosis of bacteremic pneumococcal pneumonia by amplification of pneumolysin gene fragment in serum. J Infect Dis. 1995; 171:479-82.

6. Wheeler J, Freeman R, Steward M, Henderson K, Lee MJ, Piggott NH, et al. Detection of pneumolysin in sputum. J Med Microbiol. 1999; 48:863-6.

7. Berry AM, Lock RA, Hansman D, Paton JC. Contribution of autolysin to virulence of Streptococcus pneumoniae. Infect Immun. 1989; 57:2324-30.

8. Rossjohn J, Gilbert RJ, Crane D, Morgan PJ, Mitchell TJ, Rowe AJ, et al. The molecular mechanism of pneumolysin, a virulence factor from Streptococcus pneumoniae. J Mol Biol. 1998; 284:449-61.

9. Gillespie SH. The role of the molecular laboratory in the investigation of Streptococcus pneumoniae infections. Semin Respir Infect. 1999; 14:269-75.

10. Wang Y, Wang Y, Ma AJ, Li DX, Luo LJ, Liu DX, et al. Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification. Scientific reports. 2015; 5:11902.

11. Wang Y, Yan W, Wang Y, Xu J, Ye C. Rapid, sensitive and reliable detection of Klebsiella pneumoniae by label-free multiple cross displacement amplification coupled with nanoparticles-based biosensor. Journal of microbiological methods. 2018; 149:80-88.

12. Wang Y, Li H, Li D, Li K, Wang Y, Xu J, et al. Multiple Cross Displacement Amplification Combined with Gold Nanoparticle-Based Lateral Flow Biosensor for Detection of Vibrio parahaemolyticus. Frontiers in microbiology. 2016; 7:2047.

13. Wang Y, Li H, Wang Y, Li H, Luo L, Xu J, et al. Development of multiple cross displacement amplification label-based gold nanoparticles lateral flow biosensor for detection of Listeria monocytogenes. International journal of nanomedicine. 2017; 12:473-86.

14. Wang Y, Wang Y, Xu J, Ye C. Development of Multiple Cross Displacement Amplification Label-Based Gold Nanoparticles Lateral Flow Biosensor for Detection of Shigella spp. Frontiers in microbiology. 2016; 7:1834.

15. O'Brien KL, Wolfson LJ, Watt JP, Henkle E, Deloria-Knoll M, McCall N, et al. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet. 2009; 374:893-902.

16. Seki M, Yamashita Y, Torigoe H, Tsuda H, Sato S, Maeno M. Loop-mediated isothermal amplification method targeting the lytA gene for detection of Streptococcus pneumoniae. Journal of clinical microbiology. 2005; 43:1581-6.

17. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic acids research. 2000; 28:E63.

18. Soo PC, Tseng CC, Ling SR, Liou ML, Liu CC, Chao HJ, et al. Rapid and sensitive detection of Acinetobacter baumannii using loop-mediated isothermal amplification. Journal of microbiological methods. 2013; 92:197-200.

19. Wang Y, Wang Y, Li D, Xu J, Ye C. Detection of nucleic acids and elimination of carryover contamination by using loop-mediated isothermal amplification and antarctic thermal sensitive uracil-DNA-glycosylase in a lateral flow biosensor: application to the detection of Streptococcus pneumoniae. Mikrochimica acta. 2018; 185:212.

20. Wang H, Ma Z, Qin J, Shen Z, Liu Q, Chen X, et al. A versatile loop-mediated isothermal amplification microchip platform for Streptococcus pneumoniae and Mycoplasma pneumoniae testing at the point of care. Biosensors & bioelectronics. 2019; 126:373-80.

Table 1. Bacteria strains used in this study.

ID	Strains	Sources	MCDA result
1	Streptococcus pneumoniae	ATCC49619	Positive
2-15	Streptococcus pneumoniae	Isolated strains from sputum	Positive
16	Shigatoxin-producing E. coli (STEC)	E. Coli 933	Negative
17	Enteroaggregative E. coli (EAEC)	E. Coli 042	Negative
18	Enteroinvasive Escherichia coli (EIEC)	E. Coli 44825	Negative
19	Enteropathogen Escherichia coli (EPEC)	E. Coli 2348/69	Negative
20	Enterotoxigenic Escherichia coli (ETEC)	E. Coli 10407	Negative
21	Salmonella typhi	Isolated strains from feces	Negative
22	Citrobacter freundii	Isolated strains from sputum	Negative
23	Listeria ivanovii	BAA678	Negative
24	Listeria monocytogenes	Isolated strains from blood	Negative
25	Klebsiella pneumoniae	ATCC2146	Negative
26	Streptococcus suis	Isolated strains from feces	Negative
27	Proteus mirabilis	Isolated strains from urine	Negative
28	Streptococcus salivarius	Isolated strains from dialysate	Negative
29	Neisseria perflava	Isolated strains (unknown)	Negative
30	Staphylococcus cohnii	Isolated strains from environment	Negative
31	Pseudomonas aeruginosa	Isolated strains from sputum	Negative
32	Enterobacter cloacae	ATCC700323	Negative
33	Serratia marcescens	Isolated strains from sputum	Negative
34	Candida krusei	Isolated strains from urine	Negative
35	Bacillus cereus	Isolated strains from blood	Negative
36	Escherichia coli	ATCC25922	Negative
37	Acinetobacter baumannii	Isolated strains from sputum	Negative
38	Pseudomonas aeruginosa	ATCC27853	Negative
39	Escherichia coli	ATCC35218	Negative
40	Streptococcus agalactiae	Isolated strains from sputum	Negative

Table 2. Clinical sensitivity of ply-MCDA assay.

Method	Detection limit	Sputum
ply-MCDA	4.47 CFU/reaction	447 CFU/ml
PCR	447 CFU/reaction	44700 CFU/ml

Table 3. Primers used in this study.

Primera	Sequence and modification (5'-3')	Lengthb
F1	AGGATTTAAAACAGAGAGGAATT	23nt
F2	CGCCCCCTAAAATAACCG	18nt
CP1	GAGATAGACTTGGCGCCCATTCTGCAGAGCGTCCTTTG	38mer
C1	GAGATAGACTTGGCGCCCAT	20nt
C1*	5'-FITC-GAGATAGACTTGGCGCCCAT-3'	20nt
CP2	AAGGAGTCAAGGTAGCTCCTCCCTTCACTTCTGTATTGTCCAA	43mer
C2	AAGGAGTCAAGGTAGCTCCTC	21nt
D1	GCAACACTCGAAATATAGAC	20nt
D1*	5'-Biotin-GCAACACTCGAAATATAGAC-3'	20nt
D2	AGACAGAGTGGAAGCAGA	18nt
R1	ATCACTCTTACTCGTGGT	18nt
R2	AGTAGAGGCTGCTTTTGAAG	20nt

a C1*, 5'-labeled with FITC; D1*, 5'-labeled with Biotin.

b nt, nucleotide; mer, monomeric.

Download PDF

Version 2

posted

You are reading this latest preprint version

Detection of Streptococcus Pneumoniae and elimination of carryover contamination by multiple cross displacement amplification coupled with antarctic thermal sensitive uracil-DNA-glycosylase

Status:

Version 2

Abstract

Figures

Background

Methods

Results

Discussion

Abbreviations

Declarations

References

Tables

Status:

Version 2