Research subjects
The 16-year-old female proband (III5), of Han nationality, complained of "swelling and pain in the left lower limb for 3 days". She was in good health and had no bad lifestyle-related habits, such as, smoking, drinking etc. Among the family members, her mother (II8) had a history of bilateral deep venous thrombosis of the lower extremities and pulmonary embolism, and her parents were from non-consanguineous marriages. Physical examination showed that the left lower limb of the proband had edema, especially on the dorsal foot, shank, and thigh. There were no obvious varicose veins, hyperpigmentation, skin ulceration, palpable nodules, or deep vein tenderness with a positive Homan’s sign. The circumference of both lower limbs was measured and was as follows: 15 cm above the left patella, 44 cm; 15 cm above the right patella, 39 cm; 15 cm below the left patella, 39 cm; and 15 cm below the right patella, 36 cm. The rest of the physical examination showed no obvious abnormalities. Relevant examinations were performed after hospital admission.
At the age of 39, II8 had complained of "distension and pain of the left lower limb for 2 days" in another hospital. She was in good health and had no special bad habits. Physical examination revealed swelling of the left lower limb. She was diagnosed with "deep venous thrombosis of the left lower limb" and was treated with anticoagulation and thrombolysis. After that, she improved and was discharged from the hospital and took anticoagulants regularly for a long time. A year ago, she visited the hospital again due to "sudden chest pain with loss of consciousness" and was diagnosed with "pulmonary embolism.” The father of II8 (I1) and her two older sisters (II 3 and 4) all died of pulmonary embolism and deep vein thrombosis (DVT) of the lower limbs. To date, no thrombosis has been found in other family members.
Methods
Clinical phenotype detection Clinical phenotypes and clinical biochemical indicators were collected from the proband and her related family members. Clinical biochemical indexes included PS activity, as measured using the coagulation method and the activity of protein C (PC) and antithrombin III (AT-III), as measured using the chromogenic substrate method, blood routine, coagulation function, and biochemistry.
Extraction of genomic DNA Peripheral blood (8 mL) of the proband and peripheral blood (2 mL) of each family member were collected in ethylenediaminetetraacetic acid anticoagulant tubes, and genomic DNA of the proband and her family members was extracted using the QIAGEN DNA Blood Mini Kit (Cat# 51106, QIAGEN Co., Ltd., Shanghai, China).
Location and screening strategy of mutant genes The TargetSeq® liquid probe hybridization and capture technique independently developed by Igen iGeneTech® (Beijing, China) was used to establish a genomic DNA library and capture the promoter and exon regions (16.06 Mbp) of 5,081 genes related to genetic diseases. Paired end 150 bp sequencing was performed using the Illumina X10 or NovaSeq 6000 platform. The captured target genes were PROS1 and Serpin family C member 1 (SERPINC1). Based on the results of BAM alignment with the genome reference sequence, single-nucleotide variants and indels in the samtools, GATK, and ANNOVAR sequencing results were used to remove the variation sites with intermediate frequency higher than 0.01 in ExAC, gnomAD, iGeneTechDB (local database with more than 10,000 samples), benign and likely benign mutations in ClinVar, and synonymous_variant mutations in the Human Genome Variation Society. Combined with the exon sequencing data of the parents, the sources of mutation were annotated and divided into three types: those from the father, from the mother, and suspected to be new mutations. The Hemostasis Thrombosis Expert Panel of the OMIM Phenotypic Series-PS188050 and CLINGENE were used to search for genes. Mutations from the father were excluded (the mutations from the mother and the suspected new mutations were retained), and two mutations in SERPINC1 and PROS1 were obtained. Sorting Intolerant from Tolerant (SIFT, http://sift.jcvi.org/), Polymorphism Phenotyping (PolyPhen-2, http://genetics. Bwh.harvard.edu/ppH2/) and Mutation Taster (http://mutationtaster.org/) were used to predict the pathogenicity and harmfulness of the mutations. The upper and downstream positions of the sequence of the target mutation site were designed using Premier 5.0, and the target area was amplified. The corresponding suspected pathogenic mutations were verified by Sanger sequencing using the ABI3500Dx platform. The amplified fragment length of c. 1820T > C:p, the Leu607Ser sequence of the mutation point in PROS1 (NM_000313.3), was 498 bp. The primers F: CTGGCTGGGATAGCCAAATGA and R: CTTGCTTATATTGAATCTTTGCTCTGC were used for amplification (melting temperature, 62.5 °C). The amplified fragment length of c.883G > A:p, the Val295Met sequence of SERPINC1 (NM_000488.3), was 407 bp. The primers F: CTTGCAGCTGCTCCTTCAAACT and R: TGTCTTGTGTCAATAACTATCCTCCTA were used for amplification (melting temperature, 61 °C). Synbio Technologies Co., Ltd. (Suzhou, China) synthesized all primers.
Construction and identification of PROS1 wild type (WT) and p.Leu607Ser mutant plasmids
The plasmid synthesis scheme is shown in Fig. 4a. pcDNA3.1-3×Flag-C was used as the expression vector to synthesize PROS1 with a KpnI/XhoI cleavage site. The WT plasmid 1 (PC DNA 3.1-ProS1 WT-3 × Flag-C) and the mutant plasmid 2 (pcDNA3.1-PROS1mut-3×Flag-C) were constructed, both with a KpnI/XhoI restriction enzyme site. The mutant plasmid 2 contained the 1820T>C mutation in PROS1. Target genes were amplified and sequenced. The cloning of PROS1 (WT) and PROS1 (1820T > C) and the synthesis of related polymerase chain reaction (PCR) primers were performed by Wuhan Gene Create Biological Engineering Co. Ltd(Wuhan, China).
Cell transfection
HEK293T cells were digested and collected using trypsin, and the cells were placed into a 10 cm petri dish at a density of 1–2 × 107 cells/plate in an appropriate complete culture medium. After adhesion, the total area of the cells reached 80%–90% confluence. According to the conditions of cell adhesion, cells were incubated at 37 °C in an incubator containing 5% CO2 for 8–24 h, and transient transfection was started after the cells were completely adhered. According to the instructions for TurboFect (R0531, Thermo, Massachusetts, USA), TurboFect-DNA Mix was prepared and mixed with DNA plasmids (10 μg/PROS1 WT, mutant, or control plasmid + 5 μg green fluorescent protein [GFP]) and 30 μL TurboFect in 1000 μL Opti-Medium. After incubation at room temperature for 15 min, TurboFect-DNA Mix was added to the petri dish. After 12 h, the complete medium was changed, and HEK293T cells were cultured for 48 h. Cells were observed to be in good condition by microscopy and the culture medium was collected for further evaluation.
Quantitative real-time (qRT)-PCR detection
HEK293T total RNA was extracted according to the TriPure Isolation Reagent kit (11667165001, Roche, Shanghai, China) , and the difference in the PROS1 transcription levels was detected by reverse transcription and qRT-PCR. The first chain of cDNA was synthesized according to HiFiScript (CW2020M, CWBIO, Beijing, China) . The reaction system contained 2.5 mM dNTP Mix, 4 µL; primer mix, 2 µL (primers in Table 1); RNA Template, 7 µL; 5× RT Buffer, 4 µL; 1× dithiothreitol, 0.1 M, 2 µL; 10 mM HiFiScript, 200 U/µL; and RNase-free water, 20 μL. After mixing the liquid using a vortexer, the tube was centrifuged for a short time. The product was incubated at 42 °C for 50 min and at 85 °C for 5 min. The cDNA obtained by reverse transcription was diluted 20-fold, and 40 RT-qPCR cycles were performed in a Roche LightCycler 480 (Roche, Beijing, China).
Western blot detection
HEK293T cells were cultured, lysed, total protein was extracted, and PROS1 expression was detected. Protein samples were separated using electrophoresis and then wet transferred to a polyvinylidene fluoride (PVDF) membrane, soaked in 5% skim milk prepared in Tris-buffered saline with 0.1% Tween® 20 (TBST), and sealed at room temperature for 1 h. Next, the membrane was washed once and anti-protein S antibody (97387, Abcam, UK, 1: 500) or actin antibody (ab8227, Abcam, UK, 1: 5000) was added. The Flag antibody (F3165, Sigma, USA, 1:500), diluted with 5% bovine serum albumin (BSA), was added to the membrane overnight at 4 °C, and the membrane was washed thrice. Horseradish peroxidase-labeled secondary antibodies (goat anti-rabbit IgG, 1:2,000 or goat anti-mouse IgG 1:2,000, diluted with 5% BSA, ab6721 and ab6789, respectively, Abcam, UK) were added to the membrane and then incubated in a shaker at room temperature for 1 h. The PVDF membrane was washed with TBST five times and with ddH2O once before exposure.
Enzyme linked immunosorbent assay (ELISA) of PROS1 in HEK293T cell lysates and cell supernatants
According to the instructions of the Human Protein S ELISA Kit (ab190808, Abcam, UK), the working standard liquid was prepared, and PROS1 expression in HEK293T cell lysates and cell supernatant was detected. A microplate reader (Varioskan Lux, Thermo, Massachusetts, USA) was used to measure the optical density at 450 nm immediately after the substrate solution was added to stop the reaction. A standard curve was created and PROS1 levels in the sample were calculated.
Immunofluorescence localization experiment
After being fixed, permeabilized, and blocked, the transfected HEK293T cells were incubated at 4 °C overnight with the PROS1 primary antibody (diluted 1:200). The transfected HEK293T cells were rinsed with phosphate-buffered saline (PBS) thrice, the fluorescent secondary antibody (diluted 1:500) was added and incubated at room temperature in the dark for 2 h, rinsed with PBS thrice, and stained with 4′,6-diamidino-2-phenylindole. The transfected HEK293T cells were incubated at room temperature for 5 min and rinsed twice with 1× PBS for 3 min each time. A laser confocal microscope (Nikon A1, Shanghai, China) was used to capture images.
Statistics
Experimental data were statistically analyzed using GraphPad Prism 6.02. An unpaired t-test was used to compare the two groups. The mean value was expressed as the mean ± standard error of the mean (SEM), and p < 0.05 indicated that the difference was statistically significant.