Patients and tissue specimen
Osteoarthritis tissues or corresponding normal tissues were obtained from surgically removed patients with pathological osteoarthritis (20–55 years old; 13 males and 11 females; n = 8) of The First Affiliated Hospital, College of Medicine, Zhejiang University between May 2018 and May 2019. These patients did not have diseases such as infectious diseases and cancers. All patients were informed before their inclusion, and written consent of patients was obtained. The Ethics Committee approved all experimental protocols of the First Affiliated Hospital, College of Medicine, Zhejiang University (Zhejiang, China; Ethical approval no, PRO20180916-R1) and experimental procedures were conducted Declaration of Helsinki Principles.
Cell culture
Chondrocytes (CP-H107) were obtained from Punuosai Life Technology Co., Ltd. (Wuhan, China). Dulbecco's modified Eagle's medium (DMEM, Roche, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS) (Roche, Basel, Switzerland) and 1% penicillin-streptomycin solution (Solarbio, Beijing, China) was applied to cultured cells in a humid incubator containing 5% CO2 at 37℃.
Chondrocyte inflammatory model
A total of 1×105 chondrocytes were treated with 10 µL LPS (100 ng/mL) for 24 h to induce the chondrocyte inflammation model in vitro. LPS-induced chondrocytes were applied to subsequent experiments.
Cell transfection
The transfection doses for pcDNA3.1-ASPN plasmids and its negative control pcDNA3.1-NC (synthesized by Sangon Biotech, Shanghai, China) were 500 ng for cells in each well of 6-well plates. The transfection doses of miR-4303 mimics (synthesized by Sangon Biotech, Shanghai, China) and their corresponding controls were 100 nM for cells in each well of 6-well plates. All the transfection was performed using Lipofectamine™ 3000 Transfection Reagent (Takara, Kusatsu, Japan). Following 48-h transfection, LPS-treated chondrocytes were applied to subsequent experiments.
RT-qPCR
TRIZOL reagent (Takara, Kusatsu, Japan) was applied to extracted total RNA from LPS-treated chondrocytes or osteoarthritic tissues. M-MLV Reverse Transcriptase (RNase H) kit (Takara, Kusatsu, Japan) was performed to synthesize cDNA. In addition, RT-qPCR was performed as previously described [12]. Primers applied to this research were shown in Table 1.
Table 1
Primer name | (5’-3’)Primer sequences |
F-miR-4303 | 5′- AGAAAATAGCTTCTGAGC − 3′ |
R-miR-4303 | 5′- ACCATGGTTAGCTCCTAAGCT-3′ |
F-ASPN | 5′- GGATTTTAAACGATACAAA − 3′ |
R-ASPN | 5′- GCCTTCAGTAAATGTTCATTA-3′ |
F-PDIA3 | 5’-ATGGGCCTGTGA AGGTAGTGG-3’ |
R-PDIA3 | 5’-TGACCACACCAA GGGGCATA-3’ |
F-PIK3CA | 5’-ATTTCATGAAACAAATGAATGATGCACA-3’ |
R-PIK3CA | 5’-CCATTTTTGTTGTCCAGCCACCATGAC-3’ |
F-TRAF3 | 5’-GCGTCGACCATGGAGTCGAGTAAAAAGA-3’ |
R-TRAF3 | 5’-TTGCGGCCGCTCAGGGATCGGGCAGATCCG-3’ |
F-U6 | 5′- CTCGCTTCGGCAGCACATATACT -3′ |
R-U6 | 5′- ACGCTTCACGAATTTGCGTGTC -3′ |
F-GAPDH | 5′- GAGTCAACGGATTTGGTCGT -3′ |
R-GAPDH | 5′- TTGATTTTGGAGGGATCTCG -3′ |
CCK-8 assay
According to the instructions, chondrocyte viability was analyzed by Cell Counting Kit-8 (Beyotime, Nanjing, China). In detail, LPS-treated chondrocytes, which were transfected with corresponding plasmids, were cultured in a 96-well plate. A total of 10 µl CCK-8 solution was added to each well at indicated times. Subsequently, the medium mixed with CCK-8 solution was added to a new 96-well plate. The fluorescent microplate reader was carried to detect the absorbance, which reflected cell viability at 450 nm.
EdU assay
LPS-treated chondrocytes transfected with corresponding plasmids were inoculated on 24-well plates for 48 h and prepared EdU medium was added. Following incubation for 2 h, the medium was discarded; the cells were digested with trypsin and washed twice with 1×PBS. Following fixing with formaldehyde for 30 min, LPS-induced chondrocytes were decolorized with glycine, washed with 1×PBS twice, added with 0.5% Triton X-100 for 10 min washed with 1×PBS twice again. Finally, staining was performed by cell-light™ EdU Cell Proliferation Detection (Sigma, St. Louis, MO, USA). For specific operations, please refer to the operating instructions.
Western blot
Total proteins were isolated from LPS-treated chondrocytes transfected with corresponding plasmids using cell lysis buffer (Beyotime, Nanjing, China). Western blots were conducted according to previously described [13]. All antibodies used in this research were obtained from Abcam (Cambridge, UK, 1:1000), including PCNA (ab29), Ki-67 (ab270650), CyclinA1 (ab53699), CyclinB1 (ab32053), CyclinD2 (ab207604), p27 (ab32034), Bax (ab32503), Bcl-2 (ab32124), Cleaved-casapase3 (ab32042) and Cleaved-casapase9 (ab2324). The optical density of protein bands was quantified by Image J software (ImageJ Software Inc., USA).
FACs analysis
A total of 1×105 chondrocytes were cultured in a 12-well plate using serum-free DMEM for 24 h, centrifuged at 1500 g for 5 min and washed twice with pre-cooled 1×PBS. Subsequently, cells were fixed with 70% ethanol (Solarbio, Beijing, China), placed at 20°C for 15 min, centrifuged at 1500 g for 5 min, and washed twice with pre-chilled 1×PBS. Subsequently, cells were incubated with 10 µg/µL DNase-free RNaseA (Sigma, St. Louis, USA) for 45 min at 37°C to eliminate RNA, and washed twice with pre-chilled 1×PBS. Finally, following centrifuging at 150 g for 5 min, the cells were incubated with 1 mg/mL iodide (Sigma, St. Louis, USA) in the dark at 4°C for 12 min. The cell distribution at each phase of the cell cycle is quantified in a flow cytometer and ModiFit software (Olympus, Tokyo, Japan). Besides, according to instructions, Annexin-FITC/PI Apoptosis Detection Kit (Beyotime, Nanjing, China) was combined with flow cytometry to detect cell apoptosis, according to instructions [14]. In addition, modified software (Olympus, Tokyo, Japan) was performed to analyze the data.
ELISA assay
A total of 1 mL of protein extraction reagent (Beyotime, Nanjing, China) were used to lysate chondrocytes which were transfected with corresponding plasmids, and the levels of TNF-α,IL-1β and IL-6 inflammatory factors were determined by using an ELISA kit (Roche, Basel, Switzerland), according to instructions.
Bioinformatics and double luciferase reporter assay
MiRDB was used to predict putative target genes. The luciferase vectors, including wild-type (AAGCUCUAUAUAAAUGCUCAGAG) or mutant (AAGCUCUAUAUAAAUCGAGUCUG) 3′-UTR of ASPN with the miR-4303 binding site, were purchased from Sangon Biotech (Shanghai, China). The transfection doses of wild-type or mutant 3′-UTR of ASPN were 500 ng for cells in each well of 6-well plates. MiR-4303 mimics (100 nM) and NC mimics (100 nM) were co-transfected into chondrocytes using the Lipofectamine™ 3000 (Takara, Kusatsu, Japan) according to the manufacturer's instructions. Luciferase activity was assessed using the Dual-Light Chemiluminescent Reporter Gene Assay System (Applied Biosystems, Foster City, USA) and normalized by Renilla luciferase activity [15].
Statistical analysis
The mean ± SD represented data from three independent experiments. GraphPad Prism version 5.0 software (GraphPad Software, Inc.) was used for statistical analysis of all data. Student's t-test or one-way ANOVA was used to compare two groups, and Tukey post-test was used for comparison within multiple groups. When the P-value < 0.05 indicated that the difference was statistically significant.