Isolation and identification
Out of 1231 samples examined, Salmonella was recovered from 88 (7.15%). Among the 663 clinical samples collected from man and animals with a history of diarrhoea, 68 (10.26%) were positive for Salmonella, while out of 568 samples collected from apparently healthy animals and birds, 20 (3.52%) were positive for Salmonella (Table 5). All the 88 Salmonella isolates recovered from different sources fermented glucose, mannitol and dulcitol, but did not ferment lactose and sucrose. All the isolates were positive for methyl red test, citrate utilization and hydrogen sulphide production but were negative for indole production, Voges-Proskauer (VP) test and urease production. The isolates showed yellow butt, black middle and pink top on inoculation into Triple Sugar Iron (TSI) Agar slant.
Table 1
List of Reference strains of Salmonella serotypes
Sl no | Serotype name | Strain no |
1 | Salmonella Typhimurium | MTCC 98 |
2 | Salmonella Typhi | MTCC 8767 |
3 | Salmonella Gallinarum | MTCC 2992 |
4 | Salmonella Newport | MTCC 3229 |
5 | Salmonella Virchow | MTCC 1166 |
6 | Salmonella Enteritidis | ATCC 13076 |
7 | Salmonella Poona | NCTC 4840 |
8 | Salmonella Vellore | ATCC 15611 |
9 | Salmonella Abony | NCTC 6017 |
10 | Salmonella Idikan | NICED 503984 |
11 | Salmonella Infantis | NICED 505330 |
12 | Salmonella Paratyphi A | NICED C6915 |
13 | Salmonella Paratyphi B | NICED NK3727 |
Table 2
Selected antimicrobial agents used for Antibiotic Susceptibility Testing and MIC
Sl. no. | Disc diffusion | E- test |
Antimicrobial agent | Con. (µg) | Antimicrobial agent | Con. gradient(µg/ml) |
1 | Ampicillin (AMP) | 10 | Ampicillin (AMP) | 0.016–256 |
2 | Tetracycline (TE) | 30 | Tetracycline (TET) | 0.016–256 |
3 | Cefotaxime (CTX) | 30 | Cefotaxime (CTX) | 0.016 − 256 |
4 | Ciprofloxacin (CIP) | 5 | Ciprofloxacin (CIP) | 0.002 − 32 |
5 | Gentamicin (GEN) | 30 | Gentamicin (GEN) | 0.016 − 256 |
6 | Chloramphenicol (C) | 30 | Chloramphenicol (CHL) | 0.016 − 256 |
7 | Cefepime (CPM) | 30 | Cefepime (CPM) | 0.016 − 256 |
8 | Ceftriaxone (CTR) | 30 | Ceftriaxone (CTR) | 0.002 − 32 |
9 | Trimethoprim (TR) | 5 | Co-trimoxazole (COT) | 0.002 − 32 |
Table 3
List of primers used in the study for detection of resistance genes in Salmonella
R-genes | Primer sequence | Amplicon size (bp) | Annealing temp (oC) | Reference |
blaOXA (AMP) | F-AGCAGCGCCAGTGCATCA R- ATTCGACCCCAAGTTTCC | 708 | 60 | Guerra et al. (2001) |
blaTEM (AMP) | F- TTGGGTGCACGAGTGGGT R- TAATTGTTGCCGGGAAGC | 504 | 57 | Arlet and Phillippon (1991) |
blaPSE-1 (AMP) | F-CGCTTCCCGTTAACAAGTAC R-CTGGTTCATTTCAGATAGCG | 420 | 58 | Sandvang et al. (1997) |
dfrA1 (TR) | F- GTGAAACTATCACTAATGG R- CCCTTTTGCCAGATTTGG | 470 | 50 | Guerra et al. (2001) |
dfrA12 (TR) | F- ACTCGGAATCAGTACGCA R- GTGTACGGAATTACAGCT | 463 | 50 | Guerra et al. (2001) |
tet (A) | F- GCTACATCCTGCTTGCCT R- CATAGATCGCCGTGAAGA | 210 | 57 | Ng et al. (1999) |
tet (B) | F-TTGGTTAGGGGCAAGTTTTG R-GTAATGGGCCAATAACACCG | 659 | 57 | Ng et al. (1999) |
tet (G) | F- GCTCGGTGGTATCTCTGC R- AGCAACAGAATCGGGAAC | 468 | 57 | Ng et al. (1999) |
Table 4
List of primers used in the study for detection of virulence genes in Salmonella
Target Gene | Primer sequence (5' – 3') | Primer concentration (pMol/µl) | Product size (bp) |
sipA | Forward –CGCAAATCATAAAAGATGGC Reverse-CGGCTATTATCAATCGTCTT | 20 | 646 |
sipB | Forward –CTAACGTGCTGAAACAGTTG Reverse-AACGCCACTTTATTTAGGGT | 10 | 160 |
sipC | Forward –TCTTAATGATGCGACGCTTA Reverse-TGGTCGATTTACGTGAACTT | 10 | 365 |
stn | Forward -ATTGAGCGCTTTAATCTCCT Reverse- GCTGTTGAATCTGTACCTGA | 10 | 543 |
sopB | Forward - GCATCTCTAAACGCTACTG Reverse- GCTTCTATCACTCAGCTTCA | 10 | 470 |
sopE | Forward - GTAGGGCAGTATTAACCAG Reverse- TTTATCTCCCTAGGTAGCCC | 10 | 254 |
pefA | Forward - CCAAAGTACTGGTTGAAAG Reverse- TATTTGTAAGCCACTGCGAA | 20 | 185 |
sefC | Forward - GCAGGTCCAAAACTATACA Reverse- CGATAACGAAACACCATTT | 10 | 609 |
fepA | Forward -CGACGTGTCAGAAATCATCC Reverse- GCCTTCGTCTTTATGTTCCG | 10 | 382 |
pagN | Forward -GAATCAACTCAACCTTCAGC Reverse-AGTCATAACCGATAGCAACC | 10 | 105 |
Table 5
Isolation of Salmonella from human and different species of animals and birds
Host | No. of samples examined | No. of isolates recovered |
Total | Diarrhoeic | Apparently Healthy | Diarrhoeic | Apparently Healthy |
Poultry | 405 | 302 | 103 | 17 (5.63%) | 7 (6.8%) |
Cattle | 266 | 165 | 101 | 18 (10.91%) | - |
Wild Birds | 208 | - | 208 | - | 10 (4.81%) |
Human | 143 | 83 | 60 | 28 (33.73%) | - |
Goat | 103 | 53 | 50 | - | - |
Pig | 90 | 60 | 30 | 5 (8.3%) | - |
Gecko | 8 | - | 8 | - | 1 (12.5%) |
Tiger | 6 | - | 6 | - | 1 (16.67%) |
Mice | 2 | - | 2 | - | 1 (50%) |
Total | 1231 | 663 | 568 | 68 (10.26%) | 20 (3.52%) |
Serotyping of Salmonella
Out of the 88 isolates, 21 (23.86%) belonged to S. enterica subsp. enterica serovar Weltevreden, 22 (25%) to serovar Enteritidis, 16 (18.20%) to serovar Typhi and 14 (15.90%) to serovar Newport, while 7 (7.95%) isolates were found to be untypable. Detailed results of serotyping of the Salmonella strains are presented in (Table 6). In case of human samples, S. Typhi (62.50%) was the most frequently isolated serovar, followed by serovars Weltevreden and Newport (Figure. 1). On the other hand, S. Newport (52.63%) was found to be the most abundant serovar in cattle followed by serovars Weltevreden and Enteritidis (Figure. 2).
Table 6
Distribution of various serovars among Salmonella isolates recovered from different sources
Sl. No. | Serotype | Antigenic Structure | No. of isolates | Source/ Host |
1 | Salmonella Enteritidis | 9,12:g,m | 22 | Cattle (2), Pig (1), Human (2), Poultry (13), Wild Birds (4) |
2 | Salmonella Weltevreden | 3{10},r,z6 | 21 | Poultry (5), Human (4), Cattle (7), Pig (1), Wild Birds (3), Gecko gecko (1) |
3 | Salmonella Typhi | 9,12,Vi,d | 16 | Human |
4 | Salmonella Newport | 6, 8,e, h, 1, 2 | 14 | Cattle (9), Human (2), Poultry (3) |
5 | Salmonella Typhimurium | 1,4,5,12,i,1,2 | 2 | Human |
6 | Salmonella Litchfield | 8,6,8,l,v,1,2 | 2 | Poultry |
7 | Salmonella Kentucky | 8,8,20,I,z6 | 1 | Tiger |
8 | Salmonella Idikan | 13,1,3,23,i,1,5 | 1 | Human |
9 | Salmonella Paratyphi B | 1,4,5,12,b,1,2 | 1 | Human |
10 | Salmonella Virchow | 7,6,7,14,r,1,2 | 1 | Mouse |
11 | Untypable | | 7 | Poultry (1), Pig (3), Wild Birds (3) |
Antimicrobial Resistance Detected By Disc Diffusion Test
All the 88 Salmonella isolates recovered from different sources in the present study were subjected to antimicrobial susceptibility test by disc diffusion method. Of the 88 isolates, 40 (45.45%) showed resistance to ampicillin, 54 (61.36%) to tetracycline, 60 (61.18%) to cefotaxime, 58 (65.90%) to gentamicin, 43 (48.86%) to trimethoprim, 10 (11.36%) to ceftriaxone, 9 (10.22%) to chloramphenicol, and 7 (7.95%) each to ciprofloxacin and cefepime. Of the 11 serovars, S. Weltevreden and S. Typhi and the untypable isolates showed resistance to all the antibiotics under test. Cefotaxime showed the highest resistance (61.18%), whereas ciprofloxacin and cefepime showed the least resistance (7.95%). Salmonella Virchow showed resistance to three antibiotics (Tetracycline, Gentamicin and Chloramphenicol), S. Kentucky to four (Ampicillin, Tetracycline, Cefotaxime and Gentamicin) and S. Paratyphi B to four (Tetracycline, Cefotaxime, Gentamicin and Trimethoprim) antimicrobial agents (Table 7). Ciprofloxacin resistance was shown by the isolates from poultry, wild bird, pig and human. Most of the S. Typhi isolates from human showed resistance to all the nine antibiotics tested. All the isolates from different hosts showed resistance to tetracycline except one S. Weltevreden isolate from Gecko gecko. None of the isolates of serovars S. Litchfield, S. Newport, S. Kentucky, S. Idikan, S. Paratyphi B and S. Virchow showed resistance to ciprofloxacin (Table. 8).
Table 7
Resistance patterns of Salmonella isolates of different serovars from different sources against different antimicrobial agents
Serovars | No. of isolates | Ampicillin (10mcg) | Tetracycline (30mcg) | Cefotaxime (30mcg) | Ciprofloxacin (5mcg) | Gentamicin (30mcg) | Chloramphenicol (30mcg) | Cefepime (30mcg) | Ceftriaxone (30mcg) | Trimethoprim (5mcg) |
S. Litchfield | 2 | 1 (50) | 1 (50) | 2 (100) | 0 | 2 (100) | 0 | 0 | 0 | 1 (50) |
S. Weltevreden | 21 | 7 (33.34) | 12 (57.14) | 14 (66.67) | 1 (4.76) | 10 (47.61) | 2 (9.52) | 2 (9.52) | 2 (9.52) | 10 (47.61) |
S. Newport | 14 | 9 (64.28) | 7 (50) | 7 (50) | 0 | 11 (78.57) | 3 (21.42) | 2 (14.28) | 3 (21.42) | 5 (35.71) |
S.Typhi | 16 | 5 (31.25) | 13 (81.25) | 11 (68.75) | 3 (18.75) | 10 (62.5) | 1 (6.25) | 1 (6.25) | 3 (18.75) | 8 (50) |
S. Enteritidis | 22 | 10 (45.45) | 12 (54.55) | 15 (68.18) | 1 (4.54) | 14 (63.64) | 0 | 1 (4.54) | 1 (4.54) | 13 (59.09) |
S. Kentucky | 1 | 1 (100) | 1 (100) | 1 (100) | 0 | 1 (100) | 0 | 0 | 0 | 0 |
S. Typhimurium | 2 | 1 (50) | 2 (100) | 1 (50) | 1 (50) | 1 (50) | 0 | 0 | 0 | 1 (50) |
S. Idikan | 1 | 1 (100) | 1 (100) | 1 (100) | 0 | 1 (100) | 1 (100) | 0 | 0 | 1 (100) |
S. Paratyphi B | 1 | 0 | 1 (100) | 1 (100) | 0 | 1 (100) | 0 | 0 | 0 | 1 (100) |
S. Virchow | 1 | 0 | 1 (100) | 0 | 0 | 1 (100) | 1 (100) | 0 | 0 | 0 |
Untypable | 7 | 5 (71.43) | 3 (42.85) | 7 (100) | 1 (14.28) | 6 (85.71) | 1 (14.28) | 1 (14.28) | 1 (14.28) | 3 (42.85) |
| 88 | 40 (45.45) | 54 (61.36) | 60 (61.18) | 7 (7.95) | 58 (65.9) | 9 (10.22) | 7 (7.95) | 10 (11.36) | 43 (48.86) |
Table 8
Resistance patterns of Salmonella isolates from different host species against different antimicrobial agents
Serovars | Host | No. of isolates | Ampicillin (10mcg) | Tetracycline (10mcg) | Cefotaxime (30mcg) | Ciprofloxacin (5mcg) | Gentamicin (30mcg) | Chloramphenicol (25mcg) | Cefepime (30mcg) | Ceftriaxone (30mcg) | Trimethoprim (25mcg) |
S. Litchfield | Poultry | 2 | 1 (50) | 1 (50) | 2 (100) | 0 | 2 (100) | 0 | 0 | 0 | 1 (50) |
| Wild bird | 3 | 1 (33.33) | 0 | 2 (66.67) | 0 | 1 (33.33) | 0 | 0 | 0 | 0 |
S. Weltevreden | Poultry | 5 | 2 (40) | 3 (60) | 5 (100) | 1 (20) | 4 (80) | 1 (20) | 0 | 1 (20) | 2 (40) |
| Human | 4 | 1 (28.57) | 4 (100) | 4 (100) | 0 | 2 (50) | 0 | 0 | 0 | 4 (100) |
| Cattle | 7 | 2 (28.57) | 4 (57.14) | 2 (28.57) | 0 | 3 (42.85) | 0 | 1 (14.28) | 1 (14.28) | 3 (42.85) |
| Pig | 1 | 0 | 1 (100) | 0 | 0 | 0 | 1 (100) | 1 (100) | 0 | 0 |
| Gecko | 1 | 1 (100) | 0 | 1 (100) | 0 | 0 | 0 | 0 | 0 | 1 (100) |
S. Newport | Poultry | 3 | 1 (33.33) | 1 (33.33) | 1 (33.33) | 0 | 2 (66.67) | 1 (33.33) | 1 (33.33) | 1 (33.33) | 1 (33.33) |
Cattle | 9 | 7 (77.78) | 5 (55.55) | 4 (44.44) | 0 | 7 (77.78) | 1 (11.11) | 0 | 0 | 3 (33.33) |
Human | 2 | 1 (50) | 1 (50) | 2 (100) | 0 | 2 (100) | 1 (50) | 1 (50) | 2 (100) | 1 (50) |
S. Typhi | Human | 16 | 5 (31.25) | 13 (81.25) | 11 (68.75) | 3 (18.75) | 10 (62.5) | 1 (6.25) | 1 (6.25) | 3 (18.75) | 8 (50) |
S. Enteritidis | Wild bird | 4 | 2 (50) | 1 (25) | 2 (50) | 2 (50) | 0 | 0 | 1 (25) | 1 (25) | 1 (25) |
Poultry | 14 | 8 (57.14) | 7 (50) | 9 (64.28) | 1 (7.14) | 8 (57.14) | 0 | 0 | 0 | 8 (57.14) |
Cattle | 2 | 0 | 2 (100) | 2 (100) | 0 | 2 (100) | 0 | 0 | 0 | 2 (100) |
Pig | 1 | 0 | 1 (100) | 1 (100) | 0 | 1 (100) | 0 | 0 | 0 | 1 (100) |
Human | 1 | 0 | 1 (100) | 1 (100) | 0 | 0 | 0 | 0 | 0 | 1 (100) |
S. Kentucky | Tiger | 1 | 1 (100) | 1 (100) | 1 (100) | 0 | 1 (100) | 0 | 0 | 0 | 0 |
S. Typhimurium | Human | 2 | 1(50) | 2 (100) | 1 (50) | 1 (50) | 1 (50) | 0 | 0 | 0 | 1 (50) |
S. Idikan | Human | 1 | 1(100) | 1 (100) | 1 (100) | 0 | 1 (100) | 1 (100) | 0 | 0 | 1 (100) |
S. Paratyphi B | Human | 1 | 0 | 1 (100) | 1 (100) | 0 | 1 (100) | 0 | 0 | 0 | 1 (100) |
S. Virchow | Mouse | 1 | 0 | 1 (100) | 0 | 0 | 1 (100) | 1 (100) | 0 | 0 | 0 |
Untypable | Poultry | 1 | 1 (100) | 1 (100) | 1 (100) | 0 | 1 (100) | 0 | 0 | 0 | 0 |
| Pig | 3 | 1 (33.33) | 1 (33.33) | 3 (100) | 3 (100) | 2 (66.67) | 1 (33.33) | 0 | 1 (33.33) | 2 (66.67) |
| Wild bird | 3 | 3 (100) | 1 (33.33) | 3 (100) | 1 (33.33) | 3 (100) | 0 | 1 (33.33) | 1 (33.33) | 1 (33.33) |
A total of 61 (69.32 %) isolates were found to be multi-drug resistant (MDR) and one among these isolates showed resistance to four antimicrobial agents (Cefotaxim, Tetracycline, Gentamicin and Ampicillin). Salmonella Weltevreden isolates showed resistance to Cefotaxime (92.31%) and Tetracycline (69.23%). Among the human isolates, 100% resistance was observed against Cefotaxime, Trimethoprim and Tetracycline. However, no resistance was shown against Ceftriaxone and Cefepime. Among the poultry isolates, 100% resistance was observed against Cefotaxime, while no resistance was shown against Cefepime. Salmonella Newport isolates showed 100% resistance against Gentamicin and 77.78% resistance against both Ampicillin and Cefotaxime. Among the cattle isolates, Gentamicin and Ampicillin resistance was found to be 100%, Cefotaxime resistance was 80% with no resistance to Ceftriaxone. Among S. Enteritidis isolates, Cefotaxime, Trimethoprim and Ampicillin resistance was found to be 100%, 92.86% and 35.71%, respectively. Among the poultry isolates, Ampicillin, Cefotaxime and Tetracycline resistance was found to be 50%, 100% and 60%, respectively. In S. Typhi, which is a human host-specific serovar, 83.33 % resistance was found against Cefotaxime, Gentamicin and Tetracycline each, while resistance to Chloramphenicol and Ceftriaxone were found to be 8.33% and 25%, respectively.
Mic Determined By E- Test
Most of the isolates had a MIC value of ≤ 0.125 µg/ml for Cefepime, Cefotaxim, Ciprofloxacin, Ceftriaxone and Co-trimoxazole followed by MIC value of 0.25 µg/ml for Ampicillin and Tetracycline. The MIC values of S. Newport for all antimicrobial agents were found between 1µg/ml and 16µg/ml, for S. Typhi the values were between 0.5 µg/ml and 16 µg/ml, for S. Weltevreden between 0.25 µg/ml and 16 µg/ml with only three isolates showing MIC values greater than 256 µg/ml. For S. Enteritidis, Ampicillin and Tetracycline MIC values were mostly found between 0.5 µg/ml and 8 µg/ml with three isolates showing MIC values greater than 256 µg/ml. Chloramphenicol and Gentamicin MIC values for S. Newport, S. Weltevreden, and S. Enteritidis were between 0.5 µg/ml and 4 µg/ml, whereas the corresponding values were between 0.5 µg/ml and 8 µg/ml for S. Typhi isolates (Figures. 3). For S. Typhimurium, the MIC values were found to be between ≤ 0.125µg/ml and 4 µl/ml for Cefepime, Cefotaxim, Ciprofloxacin, Ceftriaxone and Co-trimoxazole, while for the rest of the drugs, it varied from 4 µl/ml to 32 µl/ml (Table 9).
Table 9
Antimicrobial resistance phenotypes of Salmonella isolates (n = 88).
Antibiotics | Minimum Inhibitory Concentration (MIC) Distribution (µg/ml) of 88 Salmonella isolates |
≤ 0.125 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | 32 | 64 | 128 | ≥ 256 |
AMP | 0 | 1 | 5 | 23 | 27 | 7 | 6 | 5 | 2 | 1 | 0 | 11 |
TET | 0 | 0 | 23 | 33 | 12 | 4 | 7 | 4 | 2 | 1 | 0 | 2 |
CPM | 64 | 15 | 0 | 3 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
CTX | 65 | 19 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | 1 | 1 |
CIP | 65 | 12 | 1 | 0 | 0 | 2 | 2 | 1 | 5 | 0 | 0 | 0 |
CHL | 0 | 0 | 1 | 1 | 49 | 36 | 1 | 0 | 0 | 0 | 0 | 0 |
GEN | 1 | 2 | 22 | 51 | 6 | 1 | 5 | 0 | 0 | 0 | 0 | 0 |
CTR | 83 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 4 | 0 | 0 | 0 |
COT | 85 | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Detection Of Resistance Genes
Salmonella isolates showing resistance to Ampicillin, Tetracycline and Trimethoprim were further subjected to PCR for detection of resistance genes (blaTEM, blaPSE and blaOXA; tetA, tetB and tetG; drfA1, drfA12) corresponding to their phenotypic resistance patterns. Out of 41 isolates showing resistance to ampicillin, 2 (4.88%) showed presence of blaOXA gene, 1 (2.44%) showed blaPSE and 28 (63.64%) showed BlaTEM gene. Only two isolates of serovar S. Enteritidis from poultry showed presence of blaOXA and one isolate of S. Typhi from human showed presence of blaPSE. The two S. Newport isolates from human and poultry did not possess blaTEM gene. Similarly, three S. Weltevreden isolates from poultry and one isolate each from wild birds and Gecko gecko belonging to the same serovar did not show presence of blaTEM gene. All the isolates (100%) of S. Litchfield, S. Typhi, S. Typhimurium, S. Kentucky and S. Idikan as well as the untypable isolates showed presence of blaTEM gene.
Out of 54 isolates showing resistance to tetracycline, 9 (16.67%) showed presence of tetA gene and 1 (1.85%) showed presence of tetG gene, whereas none showed presence of tetB gene. Only one untypable isolate from poultry showed presence of tetG gene. However, none of the isolates of S. Newport, S. Kentucky, S. Idikan, S. Paratyphi B and S. Virchow showed presence of tetA gene. Out of the 44 isolates showing resistance to trimethoprim, 5 (11.36%) showed presence of resistance gene drfA1 but none showed presence of drfA12. The drfA1 gene was detected in two isolates each of S. Typhi and S. Enteritidis, and one isolate of S. Typhimurium (Table 10).
Table 10
Screening of Salmonella isolates from different sources for resistance genes against different antimicrobial agents
Serovars | No. of isolates showing resistance | No. of isolates showing positive for ampicillin resistant genes | Serovars | No. of isolates showing resistance | No. of isolates showing positive for tetracycline resistance genes | Serovars | No. of isolates showing resistance | No. positive for trimethoprim resistance genes |
blaOXA | blaPSE | blaTEM | tetA | tetB | tetG | dfrA1 | dfrA12 |
S. Litchfield | 1 | 0 | 0 | 1 (100) | S. Litchfield | 1 | 1 (100) | 0 | 0 | S. Weltevreden | 11 | 0 | 0 |
S.Newport | 9 | 0 | 0 | 7 (77.78) | S. Newport | 7 | 0 | 0 | 0 | S. Newport | 5 | 0 | 0 |
S. Enteritidis | 11 | 2 (18.18) | 0 | 6 (54.54) | S. Enteritidis | 12 | 2 (16.67) | 0 | 0 | S. Enteritidis | 13 | 2 | 15.38 |
S.Typhi | 4 | 0 | 1 (25) | 4 (100) | S.Typhi | 13 | 1 (7.69) | 0 | 0 | S. Typhi | 8 | 2 | 25 |
S. Weltevreden | 8 | 0 | 0 | 2 (25) | S. Weltevreden | 12 | 2 (16.67) | 0 | 0 | S. Typhimurium | 1 | 1 | 100 |
Untypable | 5 | 0 | 0 | 5 (100) | Untypable | 3 | 2 (16.67) | 0 | 1 (33.33) | S. Paratyphi B | 1 | 0 | 0 |
S. Kentucky | 1 | 0 | 0 | 1 (100) | S. Kentucky | 1 | 0 | 0 | 0 | S. Idikan | 1 | 0 | 0 |
S. Typhimurium | 1 | 0 | 0 | 1 (100) | S. Typhimurium | 2 | 1 (50) | 0 | 0 | S. Litchfield | 1 | 0 | 0 |
S. Idikan | 1 | 0 | 0 | 1 (100) | S. Idikan | 1 | 0 | 0 | 0 | Untypable | 3 | 0 | 0 |
| | | | | S. Paratyphi B | 1 | 0 | 0 | 0 | | | | |
| | | | | S. Virchow | 1 | 0 | 0 | 0 | | | | |
| 41 | 2 (4.88) | 1 (2.44) | 28 (63.64) | | 54 | 9 (16.67) | 0 | 1 (1.85) | | 44 | 5 | 11.36 |
Virulence Gene Detection
All the 88 Salmonella isolates were subjected to simplex PCR for detection of 11 important virulence genes (Table 11). The different serovars of Salmonella showed varability in their virulence gene profiles. While invA was used as the internal control for molecular detection of Salmonella, virulence genes sipA, sipB, sipC, stn and T2544 were also detected in all (100%) the Salmonella isolates, while fepA gene was present in 57 (64.77%) isolates belonging to serovars Enteritidis (12), Weltervreden (14), Typhi (14), Newport (8), Litchfield and Idikan (one isolate each), and Typhimurium (2) and the untypable (5) isolates. The rest four virulence genes sopB (86.36%), sopE (62.5%), pefA (79.54%) and sefC (51.14%) were found to be present in varying percentage among the Salmonella serovars. Maximum numbers (5) of the 17 isolates carrying all the eleven genes under study were recovered from wild birds and human. Out of all the 88 isolates screened, a total of 11 (12.5%) isolates belonging to serovars Weltervreden (7) and Typhi (4) were found to be positive for all eleven genes, while three other untypable isolates also carried all eleven genes.
Table 11
Distribution of virulence genes in Salmonella isolates of different serovars isolated from various sources
Strains | No of isolates | Genes |
invA | stn | t2544 | fepA | pefA | sopE | sopB | sefC | sipA | sipB | sipC |
S. Litchfield | 2 | 2 (100%) | 2 (100%) | 2 (100%) | 1 (50%) | 1 (50%) | 0 | 1 (50%) | 0 | 2 (100%) | 2 (100%) | 2 (100%) |
S. Weltevreden | 21 | 21 (100%) | 21 (100%) | 21 (100%) | 14 (66.67%) | 18 (85.7%) | 12 (57.1%) | 17 (80.95%) | 12 (57.1%) | 21 (100%) | 21 (100%) | 21 (100%) |
S. Newport | 14 | 14 (100%) | 14 (100%) | 14 (100%) | 8 (57.14%) | 13 (92.86%) | 11 (78.57%) | 14 (100%) | 5 (35.71%) | 14 (100%) | 14 (100%) | 14 (100%) |
S. Typhi | 16 | 16 (100%) | 16 (100%) | 16 (100%) | 14 (87.5%) | 13 (81.25%) | 13 (81.25%) | 14 (87.5%) | 6 (37.5%) | 16 (100%) | 16 (100%) | 16 (100%) |
S. Enteritidis | 22 | 22 (100%) | 22 (100%) | 22 (100%) | 12 (54.55%) | 14 (63.64%) | 11 (50%) | 20(90.9%) | 15 (68.18%) | 22 (100%) | 22 (100%) | 22 (100%) |
S. Kentucky | 1 | 1 (100%) | 1 (100%) | 1 (100%) | 0 | 1 (100%) | 1 (100%) | 1 (100%) | 0 | 1 (100%) | 1 (100%) | 1 (100%) |
S. Typhimurium | 2 | 2 (100%) | 2 (100%) | 2 (100%) | 2 (100%) | 2 (100%) | 1 (50%) | 2 (100%) | 1 (50%) | 2 (100%) | 2 (100%) | 2 (100%) |
S. Idikan | 1 | 1 (100%) | 1 (100%) | 1 (100%) | 1 (100%) | 1 (100%) | 0 | 1 (100%) | 1 (100%) | 1 (100%) | 1 (100%) | 1 (100%) |
S. Paratyphi B | 1 | 1 (100%) | 1 (100%) | 1 (100%) | 0 | 1 (100%) | 1 (100%) | 0 | 0 | 1 (100%) | 1 (100%) | 1 (100%) |
S. Virchow | 1 | 1 (100%) | 1 (100%) | 1 (100%) | 0 | 0 | 0 | 0 | 0 | 1 (100%) | 1 (100%) | 1 (100%) |
Untypable | 7 | 7 (100%) | 7 (100%) | 7 (100%) | 5 (71.43%) | 6 (85.71%) | 5 (71.43%) | 6 (85.71%) | 5 (71.43%) | 7 (100%) | 7 (100%) | 7 (100%) |
Total | 88 | 88 (100%) | 88 (100%) | 88 (100%) | 57 (64.77%) | 70 (79.54%) | 55 (62.5%) | 76 (86.36%) | 45 (51.14%) | 88 (100%) | 88 (100%) | 88 (100%) |
The distribution of virulence genes according to the source of recovery of the isolates revealed that invA, sipA, sipB, sipC, stn and T2544 genes were present in all the isolates irrespective of their source of origin. The sefC gene is present in 45 (51.14%) isolates from human, cattle, wild bird, pig, tiger and poultry. The genes sopB and sopE were present in 76 (86.36%) and 55 (62.50%) isolates, respectively, while pefA, sefC and fepA genes were present in 70 (79.54%), 45 (51.14%) and 57 (64.77%) isolates, respectively recovered from human, cattle, wild bird, pig, tiger, Gecko gecko and poultry. Currently, T2544 and sopE are re-annotated as pagN and sopE2, respectively.