Cell culture
CD34+ HSPCs from cord blood and fetal liver were obtained from the Department of Obstetrics and Gynecology at The Third Affiliated Hospital of Guangzhou Medical University, which was approved by the ethics committee of the hospital. HSPCs were purified within 24 h of scheduled apheresis. Briefly, whole cord blood was mixed with PBS in a proportion of 1:1 (v/v), and then the mononuclear fraction was separated by density gradient separation using Ficoll. CD34+ HSPCs were extracted from the mononuclear fraction using a CD34 Microbeads Kit (Miltenyi Biotech, CD34 MicroBead Kit UltraPure, human) according to the manufacturers’ protocol. Cells were stained for CD34 using APC anti-human CD34 (clone 563; BD) to test the purity. All CD34+ HSPCs were cultured in StemSpan SFEMII (StemCell Technologies) supplemented with SCF (100 ng ml -1), TPO (100 ng ml -1), Flt3 ligand (100 ng ml -1), IL-6 (100 ng ml -1), Stem Regenin1 (0.75 µM) and UM171 (35 nM). Cells were cultured at 37 °C and 5% CO2.
AAV vector production
AAV vector plasmids were cloned in the ssAAV-MCS plasmid (PackGene Biotech) containing inverted terminal repeats (ITRs) from AAV serotype 2 (AAV2) using Gibson Assembly Mastermix (New England Biolabs). The HBB AAV6 donors contained arms homologous to the beta-globin locus of 1,708 bp on the left side and 507 bp on the right side (Figure 1), the donor also contained BGH polyA, EGFP, and SFFV promoters. AAV6 vectors were produced as follows: briefly, 1X107 293T cells were seeded per 15-cm dish before transfection; each 15-cm dish was transfected with 6 µg of ssAAV-MCS plasmid containing the donor, 7.5 µg of pAAVcap6 containing the AAV6 cap genes and AAV2 rep genes and 7.5 µg of adenovirus helper genes using polyethylenimine (PEI). After incubating for 72 h, cells were lysed by three freeze-thaw cycles and then incubated with TurboNuclease (Abnova) at 250 U/ml for 45 min. AAV6 particles were purified by iodixanol density gradient centrifugation at 237,000 g for 2 h at 18 °C. AAV6 vectors were extracted at the 60-40% iodixanol interface and then exchanged in PBS with 5% sorbitol using either a molecular weight cut off (MWCO) Slide-A Lyzer G2 dialysis cassette (Thermo Fisher Scientific) following the manufacturer’s instructions. AAV6 vectors were titered using quantitative PCR to measure the number of vector genomes. The vectors were stored at -80 °C.
Design and in vitro transcription of sgRNAs
The sgRNAs targeting intron 2 of the HBB gene were designed online (https://crispr.cos.uni-heidelberg.de/), and sgRNA oligonucleotide sequences complementary to the HBB gene were annealed and cloned into the Bbsl site of PX458 (Addgene 48138). The T7 promoter was then added to the sgRNA template by PCR amplification of sgRNA expression plasmids using the corresponding primers. T7-sgRNA PCR products were purified and used as templates for the synthesis of sgRNAs using the MEGAshortscript T7 Transcription Kit (AM1354, Life Technologies, USA). All sgRNAs were purified by the RNeasy MinElute Cleanup Kit (74204, QIAGEN).
Electroporation and transduction of cells
The HBB sgRNAs were produced from in vitro transcription, and the modified sgRNA4, which had 2’-O-methyl-3’-phosphorothioate modifications at the three terminal nucleotides of the 5’ and 3’ ends, was purchased from Thermo Fisher Scientific. The sequence for sgRNA4 is as follows: 5’-GACGAATGATTGCATCAGTGTGG-3’. Cas9 protein was purchased from Thermo Fisher Scientific, and RNP was made by complexing the Cas9 protein with sgRNA at a molar ratio of 1:1 to 1:3 (Cas9 protein: sgRNA) at room temperature for 10-30 min before electroporation. CD34+ HSPCs were electroporated 2-3 days after thawing or isolation. CD34+ HSPCs were electroporated using a Neon Transfection System, and the electroporation parameters were 1,400 V-1,650 V, 10 ms, and 3 pulses. The following conditions for the 10 µl system were used: 2×105 cells, 1.5 µg cas9 protein (1 µg/µl) complexed with sgRNA at a 1:1-1:3 molar ratio. The following conditions for the 100 µl system were used: 1×106 cells, 15 µg cas9 protein (5 µg/µl) complexed with sgRNA at a 1:2.5 molar ratio. Following electroporation, AAV6 was transduced into cells immediately upon plating after electroporation at an MOI of 1×103-1×106. Then, all cells were cultured at 37 °C and 5% CO2.
T7E1 and TIDE assays
The PCR amplicon spanning the Cas9-sgRNA cleavage site was diluted in Buffer 2 (NEB) and hybridized slowly in a thermal cycler based on the manufacturer’s instructions. Hybridized fragments were then digested with 1 µl T7 endonuclease I (NEB) for 10 min at 37 °C. Then, polyacrylamide gel electrophoresis was used to separate digested fragments. Band intensities were analyzed using ImageJ software. The cleavage ratio was calculated by the ratio of the intensities of the cleaved bands to uncleaved bands. For accurate quantification of the editing efficiency, the PCR products spanning the Cas9-sgRNA cleavage site were sent for standard Sanger sequencing with both forward and reverse primers, and TIDE software (tracking of indels by decomposition) was used to quantify the indel frequencies. Primers used for amplifying PCR fragments for TIDE at the beta-globin locus are as follows: HBB-in2-DNA4F (forward primer) 5’-GAGTGAGCTGCACTGTGACAA-3’ and HBB-in2-DNA4R (reverse primer) 5’-AGAATGGTGCAAAGAGGCATGATAC-3’.
Measuring the targeted integration of fluorescent AAV6 donors and methylcellulose CFU assay
Rates of targeted integration of GFP donors were measured by flow cytometry 4 days after electroporation. The GFPhigh populations were sorted into 96-well plates containing MethoCult Optimum (Stem Cell Technologies) by FACS. After 14 days, colonies were counted under an inverted microscope and scored in a blinded fashion based on morphological features of colony forming units-erythroid (CFU-E), erythroid burst forming units (BFU-E), colony forming unit- granulocytes, monocytes (CFU-GM), and colony forming unit-multipotential cells (CFU-GEMM).
Genotyping of methylcellulose colonies
Colonies formed in methylcellulose were extracted from FACS sorting of single cells into 96-well plates. Briefly, PBS was added to the 96-well plates, and the colonies were mixed with PBS and transferred to a V-bottomed 96-well plate. Then, the cells were pelleted by centrifugation at 300 g for 5 min at room temperature, and the cells were resuspended in 250 µl of PBS after removing the supernatant. Then, the cells were pelleted by centrifugation at 300 g for 5 min again. Finally, cells were resuspended in 10 μl DNA Extraction Solution (a gift from GIBH) and transferred to PCR plates, which were incubated at 65 °C for 60 min followed by 95 °C for 10 min. In-out PCR was used to detect the integrated and nonintegrated alleles, and the integrated (one primer in the insert and one primer outside right homology arm) primers were as follows: HBB-3ARM-in-out-F1: 5’-TCCCCCTGAACCTGAAACATAAAAT-3’, HBB-3ARM-in-out-R: 5’-TTTGGGGTGGGCCTATGACA-3’. The nonintegrated (primer in each homology arm) primers were as follows: HBB-3ARM-in-out-F2: 5’-TAAAAAGGGAATGTGGGAGGTCA-3’, HBB-3ARM-in-out-R: 5’-TTTGGGGTGGGCCTATGACA-3’.
Whole-genome sequencing and Sanger sequencing
The whole-genome sequencing library was established with genomic DNA samples derived from HSPCs by next-generation sequencing (NGS) facility at the Biomarker Technologies Company. All libraries were sequenced with paired-end 150-bp reads in two Illumina Rapid Run flow cells using a HiSeq X instrument (Illumina). In contrast to the human genome Hg19, the data were analyzed through BWA.A genomic analysis toolkit (GATK, version 2.8.1). All the results of Sanger sequencing in the study were analyzed by IGE company.
Differentiation of CD34+ HSPCs into erythrocytes in vitro
HSPCs were cultured in three phases for differentiation 4 days after electroporation and transduction with AAV6. In the first phase, corresponding to days 0-7, cells were cultured at 105 cells/ml in SFEMII media supplemented with 100 U/ml penicillin/streptomycin, 2 mM L-glutamine, 100 ng/ml SCF (PeproTech), 10 ng/ml IL-3 (PeproTech), 0.5 U/ml erythropoietin (PeproTech), and 200 μg/ml transferrin (Sigma Aldrich). In the second phase, corresponding to days 7-11, erythropoietin was increased to 3 U/ml, and the cells were maintained at 105 cells/ml. In the third phase, corresponding to days 11-21, cells were cultured at 106 cells/ml, erythropoietin was maintained at 3 U/ml and transferrin was increased to 1 mg/ml. Erythrocyte differentiation was assessed by flow cytometry using the following antibodies: anti-CD71-PE and anti-CD235a-APC.
Assessment of the mRNA levels in differentiated erythrocytes
RNA was extracted from 100,000 differentiated cells between days 16-21 of erythroid differentiation with TRIzol reagent (Invitrogen). The relative quantity of mRNA was determined by real-time polymerase chain reaction (RT-PCR). GAPDH was chosen as the reference gene. The primer sequences were as follows: HBB primer (F): ATGGTGCATCTGACTCCTGA, HBB primer (R): TGGACAGATCCCCAAAGGAC; HBG primer (F): CATGATGGCAGAGGCAGAG, HBG primer (R): TGAATGTGGAAGATGCTGGA; GAPDH primer (F): TCAACGACCACTTTGTCAAGCTCA, GAPDH primer (R): GCTGGTGGTCCAGGGGTCTTACT. Quantitative mRNA expression was measured with ABI Prism 7500 Software v2.0.6 and calculated based on the comparative CT method. The expression level of each mRNA was normalized to that of GAPDH, and expression was expressed as an n-fold difference relative to the control.
Transplantation of CD34+ HSPCs into NSI mice
Six- to eight-week-old immunodeficient NSI mice were used for in vivo studies. To clear the mouse BM niche, mice were sublethally irradiated with 100 cGy 12–24 h before transplantation. Four days after electroporation/transduction, 1,000,000 cells were directly administered by tail-vein injection into the mice using an insulin syringe with a 27 gauge×0.5 inch (12.7 mm) needle for the negative control (NC), AAV only, and RNP+AAV groups. Mice were randomly assigned to each experimental group and evaluated in a blinded fashion. There were 3 mice in the NC group, 3 mice in the AAV only group and 4 mice in the RNP+AAV group. Twelve weeks after transplantation, the mice were euthanized, and the BM was harvested to determine the engraftment potential and the rate of targeted HSPCs.
Assessment of human engraftment
Twelve weeks after transplantation, mice were euthanized, and the bones were harvested from the mice (2× femur, 2× tibia, sternum, 2× pelvis, and spine) and crushed using a mortar and pestle. Mononuclear cells were enriched by using Ficoll gradient centrifugation (Ficoll-Paque Plus, GE Healthcare) for 25 min at 2,000 g at room temperature. After centrifugation, mononuclear cells were collected from the Ficoll layer and blocked to prevent nonspecific antibody binding (TruStain FcX, BioLegend) and stained (30 min, 4 °C, dark) with monoclonal antibodies: anti-human CD45 V450 (HI30; BD Biosciences); anti-HLA-ABC APC-Cy7 (W6/32; BioLegend); anti-CD19 APC (HIB19; BD Biosciences); and anti-CD33 PE (WM53, BD Biosciences). Stained cells were then washed and resuspended in FACS buffer and analyzed on a BD FACS Sort II Aria. HLA-ABC+/CD45+ cells represent human engraftment. Normal multilineage engraftment was defined by the presence of myeloid cells (CD33+) and B-cells (CD19+) within engrafted human CD45+HLA-ABC+ cells. GFP expression within engrafted human CD45+HLA-ABC+ cells was also analyzed by flow cytometry and represents the percentage of targeted cell engraftment.
Statistics
All statistical analyses were performed using SPSS Statistics (SPSS). Student’s t-tests, one-way ANOVA were used to analyze the data. P < 0.05 was considered statistically significant (* means P < 0.05; ** means P < 0.01). Figures were prepared using GraphPad Prism (GraphPad Software).