Strain and culture condition
Sclerotium rolfsii (Teleomorph: Athelia rolfsii) deposited in the Chinese Academy of Agricultural Sciences (CAAS), was used as the wild-type (WT) and cultured in potato dextrose agar (PDA; peeled potato 200 g, dextrose 20 g, agar 15 g, distilled water 1 l, pH=7.5) and in the fermentation medium (glucose 130 g, NaNO3 3 g, yeast extract 1 g, KCl 0.5 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, distilled water 1 l, pH=7.5) at 30°C. Batch fermentations were performed in a 5-L fermentor containing 3L of fermentation medium. All the components were autoclaved for 20 min at 115°C. The strain was identified by ITS primers. All primers used in this study are listed in supplementary table s1.
AAT1 identification
To identify the AAT1 gene, we first downloaded the assembled genome of Athelia rolfsii (GCA_000961905.2) from NCBI and annotated its protein-coding genes using GeneMark-ES [26] with opinions ‘--ES –fungus --sequence’. We also assembled a transcriptome data available from the NCBI SRA database for A. rolfsii (accession ID: SRS025455) using SPAdes [27] with opinions ‘--sc -s --careful -k 75’, and also annotated the protein-coding genes. All the protein-coding genes were combined and renamed starting with A0000000.
We manually selected AAT1 genes from six well-annotated fungal genomes including Scheffersomyces stipitis, Emiliania huxleyi, Kluyveromyces marxianus, Saccharomyces cerevisiae, Pseudogymnoascus destructans and Candida albicans) and BLASTed their protein sequences against the identified protein-coding genes of A.rolfsii (supplementary figure s1 a). We identified gene “A0001768” from transcriptome data as the best hit. We then confirmed that “A0001768” could cover the full-length of AAT1 by building a multiple sequence alignment using the protein sequences of “A0001768” and the six fungal AAT1 proteins using an online version of Clustal Omega [28-29]. The result was visualized by an online version of Mview [30] later.
Finally, we obtained the gene structure (i.e., the delineation of its exons) of “A0001768” (supplementary figure s1 b) by mapping its coding sequences to its assembled genome using BLAT [31].
Preparation of Cas9 protein, sgRNA and plasmids
Cas9 protein was purchased from New England BioLabs Inc. The protospacer sequences (CAGACCGGGACGACAAACCGTGG) of sgRNA named CR1-AAT1 were designed and screened against targets using Geneious software and confirmed with the online tool CHOPCHOP [32-33]. TrancrRNA and crRNA were purchased from GenePharma (Suzhou China). The assembling of guide RNA complex is described as following: mix 4.5 μl crRNA (50 μM), 4.5 μl trancrRNA (50 μM) and 10 μl duplex buffer well. Incubate the mixture at 95 °C for 5 min and cool down at R.T. for 20 min. All plasmids used in this study and their purposes are listed in supplementary table s2 and they were all purchased from Addgene.
Preparation of protoplast
Procedures of protoplast formation were carried out as described in [34], with some modified details presented here. After 90 min of incubation for depriving the cell wall, we used sterile 100 μm Cell Strainer to filter out impurities of reaction mixture.
Transformation for S. rolfsii
PEG-mediated fungal transformation was conducted according to previously described with modifications [35]. Briefly, the RNPs (ribonucleoprotein complexes which are composed of Cas9 and sgRNA) and Htb2-GFP plasmid were prepared during generation of the protoplasts where the Cas9 RNPs were made as follows: 10 μl assembled guide RNA complex (described above) and 5 μl Cas9 protein (50 μM) were added into a 50 μl total volume with 5 μl 10× Cas9 Nuclease Reaction Buffer and DEPC-treated water. This mixture was incubated in a 37°C water bath for 25 min, and 100 µL of fungal protoplasts were mixed with 20 μl Cas9 RNPs and Htb2-GFP plasmid at room temperature for 20 min. Then 40 % PEG was added into the above system and incubated at room temperature for 20 min. After STC buffer (1.2 M Sorbitol, 10 mM pH 7.5 Tris–HCl, 10 mM CaCl2) was mixing well by gently inverting the tubes several times, the total system was directly transferred into MGY regeneration medium (1% malt extract, 1% glucose, 0.1% yeast extract, 2% agar, pH 5.5) with 0.5M sucrose osmotic stabilizer. Four days later, protoplasts developed into incipient colonies observable with the naked eye, then, bottom agar was covered with 20ml top selective hygromycin-BPDA agar containing hygromycin (35 µg ml-1) and bromophenol blue (60 µg ml-1) which is a kind of indicator that changes color from yellow to blue at the pH from 3.0 to 4.6.
Fluorescence microscopy
The subcellular localization of eGFP was carried out using a Leica DMi8 fluorescence microscope. The transformants containing pDHt/sk-PE were cultured in MGY agar plate in the dark incubator at 30°C for 7 days.
Analytical method
Mycelium was obtained by germination of water-preserved sclerotia on PDA agar plate and incubated at 30 °C as previously described [36]. Then, two 250-ml Erlenmeyer flasks of 50 ml of liquid medium (MGY) were inoculated with five mycelium covered agar discs (approx. 5 mm diameter) removed from the 2-day-old PDA culture of WT and AAT1 mutant type (MT), respectively, at 30 °C on an orbital shaker at 250 rev min-1 for 45 h waiting for HPLC-MS analysis. Mycelia were frozen in the refrigerator at -80 °C. After thawing, mycelia were grinded in a mortar until mycelium was completely broken and mushy. Equal volume of ethyl acetate was added to extract and collect the ethyl acetate phase under ultrasonic condition (at 100 kHz for 1h). Rotate evaporation was used to dry the phase at 55 ℃, and added 6 ml methanol in a volumetric flask waiting to be tested about metabolites from mycelium itself, like AKG. The HPLC system (Agilent Technologies Inc., California, United States of America) was coupled with MS detector (AB SCIEX, Foster City, CA, USA) equipped with electrospray ionization (ESI) source which has positive and negative modes (ESI+ and ESI−). Reverse phase chromatographic analysis was carried out using a C-18 reverse-phase HPLC column (200 mm×4.6 mm i.d., 5 μm particle size) at 25 °C under isocratic conditions where the concentration of the mobile phase was constant throughout the run. Running conditions included a 10 μl injection volume of mobile phase methanol-0.02% acid ((NH4)2HPO4) (5:95, v/v), flow rate 0.8 ml min-1, and detection at 197 nm. Samples were filtered through a membrane filter (pore size 0.22μm, ANPEL) prior to injection in a sample loop. Standard curve and equation of linear regression were shown in supplementary figure s2. The peak areas of all oxalic acid relative standards and samples are listed in supplementary table s3.
Then we also measured the scleroglucan production in the fermentation broth between WT and AAT1-MT. The fermentation broth was diluted 5 times with distilled water, heated at 70°C for 40min, and then centrifuged at 13400×g for 25min. The precipitate obtained was washed with distilled water and dried at 105°C. An equal volume of absolute ethanol was added to the supernatant to precipitate scleroglucan. The mixture stayed on ice for 12 h to completely precipitate. In the end, the scleroglucan was recovered by vacuum drying [37].
Bioassays of acid metabolites
In order to identify that AAT1-MT could produce more acid metabolites than WT, bioassays were performed using detached peanut leaflets inoculated with an agar plug of S. rolfsii mycelia. S. rolfsii cultures were grown on potato dextrose agar plates and 5-mm plugs taken from the actively growing edge. Leaflets were wounded with a knife for 5mm on the adaxial surface, near the midvein, and plugs were placed on the open wounds. Five leaflets were inoculated for each plant line tested using a minimal quantity of agar in each plug. The plates were incubated for 36 h at 30 °C, and lesion area shown brown blight color caused by oxalic acid.
Statistical analysis
All the WT and AAT1-MT mycelium samples were designed for three biological replicates. The data from repeated HPLC analyses were pooled and subjected to ANOVA for statistical significance by least significance difference (LSD) test at P=0.01. An independent sample t-test was used for statistical evaluations between the WT and AAT1-MT groups (P ≤ 0.05) by the SPSS 21.0 software (IBM, Chicago, IL, USA).