2.1 Experiment animals
Female mice (Source: Fourth Military Medical University) (n=60, 6 weeks old, 30 animals per group, consisting of SW 0.04 mg/kg BW (SW group) and physiological saline 0.04 mg/kg BW (normal group)) were treated 21 days before mating and throughout the mating period. After 21 days of treatment, 60 female mice were observed by vaginal smear method. The day of successful mating was designated as day 0 of pregnancy. We recorded the number of implantations, number of fetuses, and number of absorbed embryos of the female mice at day 15 of pregnancy. A confirmed pregnant mouse continued to receive SW throughout the parturition and lactation periods. The female mice were sacrificed (150 ~ 200mg / kg pentobarbital sodium intraperitoneal injection, if necessary, check whether the animal's heart beats), and the blood, uterus, and ovaries were collected at day 7 or 15 of pregnancy and day 7 of childbirth. These uteruses were stained with Periodic acid-Schiff stain (PAS) at day 15 of pregnancy.
This study was performed with the approval of the local ethics committee, and all the experiments were performed according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All experimental procedures were conducted in conformity with institutional guidelines for the care and use of laboratory animals in Northwest A&F University, China, and conformed to the National Institutes of Health Guide for Care and Use of Laboratory Animals.
Fetuses and the baby mice were euthanized after the study, and the method of euthanasia was consistent with the method of collecting samples to kill the mice(150 ~ 200mg / kg pentobarbital sodium intraperitoneal injection, if necessary, check whether the animal's heart beats).
2.2 A mouse primary culture of endometrial epithelial cells
6-to 8-week-old proestrus female mice (22-30 g body weight) were selected for the experiment. Each mouse injected 5IU PMSG (Pregnant mare serum gonadotropin ) and human chorionic gonadotrophin (hCG) 5 IU after 48 h. With sterile harvest bilateral uterine surgery and first minced with a scalpel into 1-mm3 pieces in phosphate-buffered saline (PBS) solution and then digested in Hanks Buffered Salt Solution (HBBS) without Ca2+ Mg2+and containing 6.4 mg/mL collagenase type I, 125 U/mL hyaluronidase, and 0.1 nmol/L gentamycin suspensions containing single cells and luminal epithelial sheets and glandular epithelial fragments. Purified endometrial epithelial cells: Using the attached purification technology (stromal cells and epithelial cells of different adherent time: 30 min stromal cells, epithelial cells 2-24 h) cells further purification[12].
2.3 Protein extraction
Cells were treated with SW and 0.01M PBS for 12 h and 36 h, washed three times with ice-cold PBS, the cells were transferred to sterile EP tubes and centrifuged at 4℃ at1000 rpm/min for 5 min. The following operations are performed on the ice, and 107 cells treated with ice-cold radio-immunoprecipitation assay lysis buffer with 1 mM phenylmethyl sulfonyl fluoride. Repeatedly beat to protein precipitation and centrifuged at 4℃ at14,000 rpm/min for 15 min. The supernatant, which contained total protein extracts of cells, was aliquoted and stored at -80℃. Protein concentration was determined using the BCA Protein Assay Kit [13].
2.4 N-glycopeptide enrichment by hydrophilic interaction chromatography (HILIC)
8g protein sample added UA buffer(8M urea,0.1 M Tris-HCl,pH=8.0), and 4μL DTT to 300ul. Mixed sample centrifuged at 4℃ at14,000 rpm/min for 10 min. And then 180μL UA buffer and 4μL DTT(20mM) added to Ultrafiltration tube at 37℃ oven for 4h. The mixture were centrifuged at 4℃ at14,000 rpm/min for 15 min; To join the 180 uL UA buffe and 10 uL IAA (50 mm), mix vortex, and reacted 30 min in the dark room. After it were high-speed centrifuged at 4℃ at14,000 rpm/min for 15min and added 200ul UA buffer by high-speed centrifugal x 15 min (14000 g),and repeat this step once; Continue to join 200 u L to sialic acid reaction buffer,high-speed centrifugal x 15 min (14000 g), and repeat twice. After the effluent was discarded, 180 uL of desialic acid Buffer was added to the ultrafiltration tube, desialidase was added, and the enzyme was digested overnight. Centrifugation was performed at a high speed (14,000g×15 min). After the effluent was discarded, 200uL 50mM NH4HCO3 was added for centrifugation at a high speed (14,000g×15 min) and repeated twice.After the effluent was discarded, a new receiving tube was replaced, and 180uL 50mM NH4HCO3 was added to the ultrafiltration tube, and according to the protein: PNG-F enzyme (100:1 quality ratio,) PNG-F enzyme and 1% Rapigest were added, enzyme digestion at 37℃for 16 h. Elution and collection of carbohydrate chain : The ultrafiltration tube after 16h of enzymatic hydrolysis reaction was placed in a high-speed centrifuge for high-speed centrifugation (14000g×10 min). It was eluted twice with 50mM NH4HCO3 (prepared when using), 150uL each time, centrifuged at high speed (14,000g×10 min), and eluted with 150uL double distilled water, centrifuged at high speed (14,000g×10 min).The above solution was recovered, combined, acidified with 0.1%TFA, and freeze-dried for later use [14].
2.5 N-glycan enzyme activity analysis
The protein was extracted from a mouse primary culture of endometrial epithelial cells. The α-mannosidase-I, α-mannosidase-II, N-acetylglucosaminyltransferase-I and N-acetylglucosaminyltransferase-II concentrations were measured using a mouse enzyme-linked immunosorbent assay (ELISA) kit (Good ELISA Kit Producers) according to the manufacturer’s instructions. Endometrial epithelial cell culture supernates for 20 minutes at 1000×g. Particulates were removed and assayed immediately or samples were stored in aliquot at -20℃ or -80℃ for later use, avoiding repeated freeze/thaw cycles.
2.6 Serum reproductive hormone assay
Mouse serum was collected at days 7 and 15 after pregnancy and day 7 after childbirth. Serum follicle-stimulating hormone (FSH), luteotropin (LH), 17β-estradiol (E2), and progesterone (P4) were measured using a mouse ELISA kit (Biostest, EM2088, EM2089, EM2093, HM2061) according to the manufacturer’s instructions.
2.7 Real-time polymerase chain reaction (PCR)
Total RNA was extracted using Trizol reagent from mouse ovaries at days 7 and 15 of pregnancy and day 7 after childbirth. For the removal of residual genomic DNA, these samples were treated with DNaseI. The first-strand cDNA was synthesized using a first strand cDNA synthesis kit, and quantitative real-time PCR was carried out using SYBR Green (SYBR Green Real-time PCR Master Mix QPK-201; Toyobo Co., Japan.). Specific PCR settings were used in a Bio-Rad iQ5 Real-time PCR system. To verify PCR product purity, samples were subjected to melting curve analyses after real-time PCR reactions. The threshold cycle (CT) numbers were calculated for the amplified cDNA for each investigated mRNA and for the housekeeping gene (β-actin) in each sample. The forward and reverse primers for P450scc(cholesterol side-chain cleavage enzyme) were as follows: (forward: 5’- GAGAGAGAGAAGGATCCAAG AGCT-3’; reverse: 5’- GAGAGAG AGATT CTCGAGTT-3’ product size 165 bp), StAR (steroidogenic acute regulatory protein) (forward: 5’-AGAAGTTCAAGTT GT-3’; reverse: 5’-CTTGCTCTCCTCGA-3’ product size 202 bp), HSD-3β (3beta-hydroxy steroid dehydrogenase) (forward: 5’-GGCTTCCAACCATCTAAC A-3’; reverse: 5’-CTCCTTCTCCTCCACCAA-3’ product size 179 bp), CYP19A1 (cholesterol side-chain lyase) (forward: 5’-GACTC CGGTACGGACG-3’; reverse: 50-TCTTAAGTACGCTC-30 product size 207 bp) [13].
2.8 Western blot
Total protein was extracted using RIPA reagent from mouse ovaries at days 7 and 15 of pregnancy and day 7 after childbirth. Firstly,rinsed the ovaries three times with ice-cold PBS and lysed in radioimmunoprecipitation assay (RIPA) buffer with 1% phenyl methylsulfonyl fluoride (PMSF) for 5 minutes. Secondly, centrifuged the lysates at 15,000 g at 4℃ for 10 minutes and collected the supernatants. Thirdly,determined the protein concentrations by the BCA protein assay kit (ThermoFisher Scientific, Waltham, MA, USA). Fourthly,electrophoresed ovary lysates(30 mg/lane) with 10% SDS-PAGE and then transferred them onto polyvinylidene fluoride (PVDF) membranes. Fifthly, blocked the membranes with 5% skim milk at room temperature for 2 hours. Sixthly,incubated the membranes with specific primary antibodies (1:1000 in PBS buffer) recognizing P450scc, StAR, HSD-3β, CYP19A1, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Cell Signaling Technology, Danvers, MA, USA)at 4℃ overnight . Seventhly,after washing with Tris-buffered saline (TBS) (pH8.0) containing 0.1% Tween-20, horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (IgG, Bioworld Technology Co., St Louis Park, MN, USA) in washing solution was added and incubated for 1 hour at room temperature.Finally, immunoreactive proteins were detected using SuperSignal chemiluminescence and protein bands were digitally imaged for densitometric quantification using a software program (Eastman Kodak Company, Rochester, NY, USA).
2.9 Statistics
For each experiment, 4 to 5 female mice per group were used. Data were reported as mean±SD. Statistical analysis was performed by SPSS software and included Student’s t-test or one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test. A P value < 0.05 was considered significant. *P<0.05 each group versus the control group at the same time.