2.1 Patients
Our retrospective study was approved by the ethics committee of the Jinan Infectious Disease Hospital (JCLL-2016-04). A total of 75 patients diagnosed with chronic nephritis between 2008 and 2016 at the Jinan Infectious Disease Hospital and Qilu Hospital of Shandong University, Shandong Province, China, were included in the study. The experimental group consisted of 50 HBV-GN patients and the negative control group consisted of 25 CGN patients. Each patient received kidney puncture biopsy under ultrasound guidance to attain nephridial tissue for diagnosis and subsequent study. Participation was dependent upon fulfillment of the following criteria:(1) patients must not have used an immune agent or antiviral agent in the past three months; (2) patients must not have HAV, HCV, HDV, HEV, or HIV co-infection; (3)patients must not have a history or current evidence of secondary glomerulonephritis; and (4) consent for participation must have been obtained from those who participated.
2.2 Diagnosis of HBV-GN, CGN and pathological classification of HBV-GN
The diagnostic criteria used for CGN and HBV-GN were in accordance with the 2002 Kidney Disease Outcome Quality Initiative (K/DOQI), edited by the National Kidney Foundation (NKF) [15]. The diagnosis of HBV-GN was confirmed by pathology. The pathological classification of and diagnostic criteria used for HBV-GN were in accordance with 1990 WHO classification criteria [16]. Frozen slices from biopsies of the 50 HBV-GN patients were kept in a low-temperature freezer. Monoclonal goat-anti-human HBsAg and HBcAg antibodies were purchased from Dako (Denmark), and immunohistochemical staining for HBsAg and HBcAg in renal biopsies and an electron microscope was used for detection of HBV to confirm the diagnosis (Figs. 1 and 2A). For HBV-GN patients with undetectable HBsAg or HBcAg in nephridial tissue, HBV was detected using the JCM-6000 scanning electron microscope from Jeol. Ltd (Japan). Sections from all biopsy specimens were routinely stained with hematoxylin and eosin (H&E), periodic acid-sliver methenamine (PASM), Masson’s trichrome, and antibodies against IgA, IgG, IgM, C3, and C1q complement component. Fluorescently-labeled IgA, IgG, IgM, C3, and C1q rabbit-anti-human antibodies were purchased from Dako.
2.3 Immunohistochemistry and scoring
Immunohistochemistry was carried out using standard techniques. Nephridial and hepatic tissue specimens were first fixed in 10% formalin, then the tissue was cut, dehydrated, dipped in wax, embedded, and sectioned. These sections were then placed on slides, baked, placed into xylene, cleared of the wax, rehydrated using graded ethanol, and immersed in 0.3% hydrogen peroxide for five minutes to reduce non-specific background staining caused by endogenous peroxidase. The slides were then washed with PBS buffer three times for five minutes each, placed in citrate buffer solution at a pH of 6.0, and then into a high temperature pressure pot to recover the tissue antigen. After being heated, the slides were cooled and restored to room temperature, washed three more times in PBS buffer, and incubated with AIM2 (ab93015, rabbit anti-human polyclonal antibody, Abcam, USA), caspase-1 (sc-56063, mouse anti-human polyclonal anti- body, Santa Cruz Biotechnology Inc., USA), and IL-1β antibodies (ab2105, rabbit anti-human polyclonal anti-body, Abcam), respectively. The slides were then placed in a 4°C refrigerator overnight. The next day, the slides were washed with PBS buffer three times, each time lasting longer than five minutes, then incubated with the secondary antibody PV-9000 (universal antibody) at 37°C for 10 minutes, washed with PBS buffer, and DAB stain was applied. The stain was terminated using running water, and then the slides were washed with hydrochloric acid alcohol for differentiation. Finally, the slides were washed with distilled water, cleared with xylene, and mounted. Appearance of a tan stain in the cytoplasm signaled positive expression of the protein. After staining, scores were assigned based on stain intensity and percentage of positive cells as follows. For stain intensity, a score of 0 was given for no brown staining (i.e., no cells stained), 1 for light brown, 2 for brown, and 3 for dark brown. For percentage of positive cells, a score of 0 was given for fewer than 5% positive cells, 1 for 5–30%, 2 for 30–60%, and 3 for greater than 60%. Scores for stain intensity and percent positive were then added together, and a negative sign (−) was assigned for scores totaling 0, mildly positive (+) for scores between 1 and 3, moderately positive (++) for scores between 4 and 6, and strongly positive (+++) for scores greater than 7.
2.4 Cell lines and reagents
The human glomerular mesangial (HGM) cell line and HEK-293T cell line used in this study were purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS (Life Technologies, Carlsbad, CA, USA), ampicillin and
streptomycin at 37°C under 5% CO2. HBV expression plasmids were constructed with a pcDNA3.0 vector. The 1.1-fold over length HBV genome was cloned into the pcDNA3 vector to generate pcDNA3.0-1.1HBVDNA, 1.1HBV as the expression gene and ampicillin resistance for antibiotic selection (Amresco, Penn- sylvania, USA). We designed three kinds of IFI16-siRNAs for this experiment, which were synthesized by Gene Pharma (Shanghai, China).. The siRNA was synthesized accordingly:
siRNA #1: GGAAGUGGAUGCUACUUCAdTdT;
siRNA #2: GGAAUAUGAUAGUCUCCUAdTdT;
siRNA #3: GGAAGUGGAUGCUACUUCAdTdT;
siRNA negative control: GAUGAGAUUAGAUACUCUCdTdT.
IFI16-siRNA#2 was selected as the most effective silencer compared with the others, which was used for the following experiment (Fig. 4a). IFI16, Caspase-1, and IL- 1β antibodies were obtained from Cell Signaling Tech Abcam (Cambridge, MA, USA).
2.5 Cell transfection
The HGM cell line and HEK-293T cell line were seeded into 12-well plates, then the cells were transfected with either pcDNA3.0-1.1HBVDNA- IFI16 and negative control for overexpression studies, or with siIFI16 and a scrambled siRNA for knockdown studies. Lipofectamine 2000 (Invitrogen) was used according to the manufacturer’s instructions with minor modifications for transfection studies. IFI16 overexpression and knockdown were confirmed by qRT-PCR and Western blot 48 h post transfection.
2.6 Western blot
According to the manufacturer’s instructions, whole cell protein extracts were prepared and were separated using 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis. Proteins were then transferred to a polyvinylidene difluoride membrane (Millipore, Bed- ford, MA, USA), according to the instruction manual. Membranes were blocked overnight in 5% w/v low- fat dry milk in 10 mmol/L Tris- HCl, pH 7.5, 0.1 mol/L NaCl and 0.1% Tween- 20 and incubated with primary antibodies overnight at 4°C. After washing with TBST buffer, the blots were then incubated with HRP- conjugated secondary antibody for 2 hours at room temperature. After washing with TBST buffer, immunoreactive bands were visualized using the ECL- Plus reagent (Millipore, Billerica, MA, USA). GAPDH was used as the loading control in Western blotting.
2.7 RNA Isolation and qRT-PCR
Total RNA was isolated using Trizol RNA reagent (Invitrogen, California, USA). Quantitative real- time PCR was performed, and the expression levels of IFI16, caspase-1, and Il-1ß mRNA were normalized to GAPDH for gene expression. The primers are listed in Table 3.
Table 3
Primers’ sequences used in qRT-PCR in this study
ID | Sequence (5′-3′) |
IFI16 F IFI16 R caspase-1 F caspase-1 R Il-1ß F Il-1ß R GAPDH F GAPDH R | AGCTCAGAACCCGAAAACAG TCTGTGTAGCCACTGTAGCA GTTCCATGGGTGAAGGTACA GACATTCCCTTCTGAGCCTG AGCTACGAATCTCCGACCAC CGTTATCCCATGTGTCGAAGAA TGTTCGTCATGGGTGTGAAC ATGGCATGGACTGTGGTCAT |
F: forward primer; R: reversed primer. |
2.8 Statistical Analysis
The SPSS program (version 19.0) and GraphPad Prism (version 8.0) were used for analysis. Measurement data are described as mean ± standard deviation. Background factors were compared using the Student’s-test (numerical data) or the Chi-square test (categorical data). The Spearman’s two-tailed test was used for correlation analysis, and differences were regarded as significant if the p value was less than 0.05 on either side.