Mouse Samples and experimental groups
A pilot study used cryopreserved metaphase II oocytes and one-cell in vivo fertilized embryos from B6C3F1/B6D2F1 mice (Embryotech Laboratories, Inc., Wilmington, MA). Oocytes and one-cell embryos were thawed by removing them from liquid nitrogen container then exposing them to room temperature for 2 minutes. Each straw was moved to a 37°C water heated container for 1 minute before cutting the straw and transfering the samples to a Petri dish containing M2 culture medium (EmbryoMax® M2 Medium, 1X). Oocytes and embryos were washed three times in M2 medium. MII oocytes were individually stored in sterile PCR microtubes containing 1 µL 0.1 % phosphate buffered saline (PBS; Invitrogen, Grand Island, NY, USA) - polyvinylpyrrolidone (PVP, Sigma-Aldrich, St. Louis, MO, USA) in -80 o C for further analysis.
One-cell mouse embryos were in vitro cultured for 48h in potassium simplex optimized medium (KSOM, Merck Millipore, Germany) under mineral oil at 37°C in 6% CO2 in humidified air with no AZT (control group, n = 45), or AZT 1 µM (n = 46) or 10 µM (n = 48) for 48 hours. After 24 or 48 hours in culture, embryo developmental stage was evaluated. Embryos still viable after 48 hours in culture were individually stored in sterile PCR microtubes containing 1 µL 0.1 % PBS/PVP in -80 oC for further analysis.
Oocyte single-cell genomic DNA and embryo genomic DNA were obtained by adding 1 µL lysis buffer 2× (100 mM Tris · HCl pH 7.4, 300 mM NaCl, 0.8 mM EDTA, 2 % (vol/vol) Nonidet P-40, and 5 mM DTT) into PCR microtubes and heated at 75°C for 15 min. and cool down at room temperature. Oocyte single-cell genomic DNA and embryo genomic DNA were individually stored at -20°C until performing single-cell quantitative PCR (SC-pqPCR) to evaluate mean telomere length and qPCR to determine LINE-1 copy number.
Telomere length assay in individual oocytes and mouse embryos
A single-cell amplification of telomere repeats (SCATR) PCR (previously known as SCT- pqPCR) [12] was used to measure telomere length in each oocyte and embryo. A key feature of this assay is a telomere pre-amplification step, performed before quantitative polymerase chain reaction (qPCR). Mean telomere length (T/R ratio) was calculated by comparing the values of telomere DNA (T) and reference gene m36B4 (R) in individual oocytes and embryos. In brief, pre-PCR was performed using DNA Polymerase Hot Start Version (TAKARA). The reactions were set up by aliquoting 38 µL of master mix into the PCR microtubes containing 2 µL oocyte/embryo single-cell genomic DNA. Each reaction was set up with 4 µL 10 × PCR buffer, 4 µL 2.5 mM dNTP, 0.25 µL DNA polymerase, 1 µL each of telomere forward and reverse primer (10 µM, TeloF: 5′ CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT 3′; TeloR: 5′ GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT 3′) and 1 µL each of reference genes forward and reverse primer (10 µm, m36B4-F: 5’ACTGGTCTAGGACCCGAGAAG’3; m36B4-R: 5’ TCAATGGTGCCTCTGGAGATT’3), and water to a 40 µL final volume. Thermal cycler reaction conditions were 95°C for 10 minutes followed by 40 cycles of data collection at 95°C for 15 seconds, 60°C annealing for 30 seconds and 72°C extend for 30 seconds along with 80 cycles of melting curve from 55°C to 95°C.
PCR products were purified following the protocol of the purification kit (DNA clean and concentrator-5; Zymo Research, USA) and were eluted in 64 µL of double distilled water. Finally, the purified products from each individual oocyte were aliquoted into each well of a 96-well plate to perform the real-time PCR. Each sample was run in triplicate along with a target-specific no-template control (NTC). Positive controls were allocated to random wells on random plates to assure plate-to-plate concordance and DNA from HeLa cells (New England Biosciences, Ipswich, MA, USA) were serially diluted (20, 4, 0.8, 0.16, and 0.032 ng/µL) as a reference for standard curve calculation. After thermal cycling was completed, the CFX manager software was used to generate standard curves and Ct values for telomere signals and reference gene (m36B4) signals. To ensure high reproducibility of samples, only assays with real-time PCR efficiencies between 95 and 105 % and intra-assay coefficient of variation (CoV) less than 1 % were included in analysis.
LINE-1 copy number assay in individual oocytes and mouse embryos
LINE-1 copy number was calculated by comparing the values of LINE-1 (T) and mB1 as a reference (R). Pre-PCR was performed as described above. Each reaction was set up with 4 µL 10xPCR buffer, 4 µL 2.5 mM dNTP, 0.25 µL DNA polymerase, 1 µL each of LINE-1 forward and reverse primer (10 µM, LINE-1F: GAACCAAGACCACTCACCATCA; LINE-1 R: CCCTGGACTGGGCGAAGT), 1 µL each of reference genes forward and reverse primer (10 µm, mB1-F: GCACCTTTAATCCCAGCAC e mB1-R: TGAGACAGGGTTTCTCTGTA), and water to a 40 µL final volume. Thermal cycler reaction conditions were set at 94°C for 5 minutes followed by 15 cycles of 94°C for 30 seconds, 60°C annealing for 30 seconds and extension at 72°C for 30 seconds, with a final extension for 10 minutes at 72°C. PCR products were purified following the protocol of the purification kit (Agencourt AMPure XP beads) and were eluted in 50 µL of double distilled water.
Finally, purified products from each individual sample were aliquoted into each well of a 96-well plate to perform the real-time PCR. Each reaction included 10 µL 2× SYBR Green mix (Bio-Rad), 1 µL each of 10 µM forward and reverse primers, 4 µL molecular-filter water and 5 µL genomic DNA to yield a 20-µL reaction. DNA samples were placed in 96-well plate for LINE-1 primers and reference gene primers, respectively. A Bio-Rad thermal cycler (CFX system test) was used with reaction conditions of 95°C for 10 minutes followed by 40 cycles of data collection at 95°C for 15 seconds, 60°C annealing and extension for 1 minute. Each sample was run in triplicate along with a target-specific non-template control (NTC). DNA from mouse embryonic stem cells was used as positive control in each plate to assure concordance between plates. After thermal cycling was completed, the CFX manager software was used to generate standard curves and Ct values for LINE-1 and reference gene (mB1). To ensure high reproducibility of samples, only assays with real-time PCR efficiencies between 95 and 105 % and intra-assay coefficient of variation (CoV) less than 1 % were included in analysis.
Statistical analysis
The percentage of morula stage embryos at 48 hours was compared among groups by Fisher’s Test. TL and LINE-1 copy number were compared by Kruskal Wallis’ Test and Dunn’s Post-Test. A p value less than 0.05 were considered significant. Statistics were performed on SPSS 20.0 software (IBM SPSS Software, Armonk, NY, USA), and graphs were plotted using GraphPad Prism 5 software (GraphPad Software, La Jolla, CA, USA).