2.1 Materials
Phosphoethanolamine, calcium gluconate, diethylenetriamine pentaacetic acid (DTPA), and glycine were purchased from Aladdin Reagent Company (Shanghai, China). Fetal bovine serum and Dulbecco’s minimum essential medium (DMEM) were procured from Hyclone (Logan, UT, USA). Lyso tracker and Mito tracker were purchased from Beyotime Biotechnology (Beijing, China). qPCR kits were purchased from Sigma (NY, USA). ICR mice were purchased from Center for Experimental Animals of Jiangsu University. Recombinant Human Bone Morphogenetic Protein-2 (rhBMP-2) was obtained from R&D Systems Europe (United Kingdom). All of these chemical agents were of analytical grade and were utilized without further purification.
2.2 Synthesis of P-CDs, Ca-CDs and Ca/P-CDs
Three types of CDs were synthesized using different precursors by a one-pot hydrothermal method, as described in the literature previously with a little modification [16]. P-CDs: 0.4 g of phosphoethanolamine and 0.40 g of DTPA were dissolved in 20 ml of double-steaming water and stirred continuously for 10 min to form a transparent solution. The solution was transferred to a reaction kettle and heated in a muffle furnace at 200°C for 4 h. After the system was cooled to room temperature naturally, the liquid was poured into a 50 ml centrifugal tube and the black impurities are removed by centrifuging at 2000 rpm for 15 min. The prepared solution was then dialyzed against water for 5 days in a cut-off dialysis bag (MWCO = 3 kD, Solarbio Company, Beijing, China). The dialysate was collected and freeze-dried with vacuum freeze dryer. Thus, P-CDs powder was obtained and stored for further characterization. The Ca-CDs and Ca/P-CDs were prepared using calcium gluconate and DTPA, and phosphoethanolamine and calcium gluconate as precursors, respectively.
2.3 Morphological and chemical characterization of Ca/P-CDs
The morphologies of the Ca/P-CDs were observed by high-resolution transmission electron microscopy (HRTEM) on a JEM-2100 microscope (JEOL, Tokyo, Japan) under an accelerating voltage of 200 kV. Elemental composition of the Ca/P-CDs was determined by X-ray photoelectron spectroscopy (XPS) on Escalab 250Xi (Thermo Scientific, America). The surface chemical components of Ca/P-CDs were examined using a Fourier transform infrared (FT-IR) spectrometer (Nicolet Nexus 470; GMI, Franklin, IN, USA) ranged from 4000 to 400 cm − 1. The crystal structure of Ca/P-CDs was analyzed by x-ray diffraction (XRD) on a Rigaku-D/MAX2500 diffractometer (Japan) with a scanning speed of 4 °/min in the range from 5–90 °. The optical properties of the Ca/P-CDs were obtained with a UV-2450 UV/vis spectrophotometer (Shimadzu, Japan), and the photoluminescence emission spectra was recorded using a Cary Eclipse Fluorometer (Varian, Palo Alto, CA, USA).
2.4 Cell culture and biocompability of Ca/P-CDs
In vitro cytotoxicity of the Ca/P-CDs was determined using the CCK-8 cell viability kit assay ( Solarbio, Beijing, China). Briefly, MC3T3-E1 (mouse embryo osteoblast precursor) cells (1×104 cells per well) were seeded into a 96-well plate with four replicates in each group. After incubation at 37°C and 5 % CO2 for 24 h, the different concentrations of Ca/P-CDs (50 µg/mL) in fresh DMEM were used to replace the growth medium and incubated for another 24 h. Then, the cells were washed with PBS, and 10 µL CCK-8 and 90µl DMEM solution were added to each well. Next, the plates were incubated for 4 h at 37°C and 5 % CO2. Finally, the absorbance of each well was detected at the emission wavelength of 450 nm using a Synergy HT Multi- Mode Microplate Reader (Bio Tek, Winooski, VT, USA). Nontreated cells (in DMEM) were used as a control, and the relative cell viability (mean ± SD, n = 3) was expressed as (Abs sample − Abs zero sitting)/(Abscontrol-Abszero sitting) × 100 %. The experiment was repeated three times independently.
2.5 Hemolysis assay
All animal procedures were conducted in accordance with the Management Rules of the Ministry of Health of the People’s Republic of China and approved by the Institutional Animal Care and Use Committee of Jiangsu University (permit number: SYXK2018-053). The hemocompatibility of Ca/P-CDs was carried out according to the protocol reported in the literature with slight modification [13]. In brief, fresh mouse blood was stabilized with heparin sodium and centrifuged (1, 200 rpm, 15 min) to remove the supernatant. The sediment was washed with PBS five times to obtain the mouse red blood cells (MRBCs). Next, the mouse RBCs were resuspended using 0.9 mL PBS containing Gd-doped CDs with different particle concentrations from 50 to 200 mg/mL (water as positive control and PBS as negative control). These samples were incubated for 2 h at 37°C after gentle shaking, thus centrifuged to collect the supernatant at 12,000 rpm for 1 min. The absorbance of samples at 541 nm was recorded by a UV-Vis spectrophotometer (UV-2450). The hemolysis percentages of Ca/P-CDs was calculated using the absorbance compared with the control.
2.6 Cytophagocytosis assay
The internalization of Ca/P-CDs in the cells was observed using laser confocal microscope. The MC3T3-E1 cells were seeded into the 24-well plates that pre-filled with 10 mm coverslips. When the cell density reached 60 %, the MC3T3-E1 cells were administered with the medium containing 200 µg/ml of Ca/P-CDs and further incubated for 4 h. Then, these MC3T3-E1 cells on the coverslips were washed with phosphate-buffered saline (PBS) twice and fixed with 4% paraformaldehyde (PFA). In order to determine the intracellular distribution, these MC3T3-E1 cells stained with Lyso tracker and Mito tracker were observed under a confocal laser scanning fluorescence microscope (Zeiss LSM-710, Carl Zeiss Meditec AG, Jena, Germany)
2.7 Alizarin red staining
Alizarin red staining was choosed to verify the osteogenic differentiation of MC3T3-E1 cells after incubation with Ca/P-CDs. MC3T3-E1 cells were seeded into a 96-well plate at a density of 1×104 cells per well with four replicates. After incubation with 50 µg/mL Ca/P-CDs for 21 days, the MC3T3-E1 cells were washed with PBS and fixed with PBS paraformaldehyde (3.6 %) for 1 hour at 4℃. Then, the MC3T3-E1 cells were stained with 1% alizarin red (sigma Aldrich) solution for 30 minutes. Finally, these MC3T3-E1 cells were washed by PBS to remove free alizarin red, and the Ca/P-CDs-induced mineralization was measured by microscope and Image-J software.
2.8 Real-time PCR
The osteogenic induction of MC3T3-E1 cells using Ca/P-CDs was same as the above. When the induction was over, these MC3T3-E1 cells were collected by enzymatic digestion, and their total RNA was extracted by Trizol reagent. RT-PCR was conducted on the ViiA 7 RT-PCR System (Thermo Fisher Scientific) using the QuantiTect SYBR Green Kit (Qiagen, Quanta, France). The primer sequences of the related genes were listed in the Table 1. The expression of each related gene, including alkaline phosphatase (ALP), osteocalcin (OCN), and Runt-related transcription factor 2 (RUNX2), was normalized to the housekeeping gene (β-actin), and fold differences were calculated using the comparative Ct method. The osteogenic markers ALP, OCN and RUNX2, were analyzed.
Table 1
Primer sequences of real-time PCR reactions
Name | Primer | Sequence | Product |
ALP | Forward | 5′AACCCAGACACAAGCATTCC3′ | 151 |
| Reverse | 5′GAGAGCGAAGGGTCAGTCAG3′ | |
RUNX2 | Forward | 5′AGAGTCAGATTACAGATCCCAGG3′ | 238 |
| Reverse | 5′TGGCTCTTCTTACTGAGAGAGG3′ | |
OCN | Forward | 5′TGCTTGTGACGAGCTATCAG3′ | 149 |
| Reverse | 5′GAGGACAGGGAGGATCAAGT3′ | |
β-actin | Forward | 5′TCTTGGGTATGGAATCCTGTG3′ | 81 |
| Reverse | 5′AGGTCTTTACGGATGTCAACG3′ | |
2.9 In vivo animal study
Mice calvarial defect model creation and Ca/P-CDs loaded hydrogel implantation
All animal procedures were conducted in accordance with the Management Rules of the Ministry of Health of the People’s Republic of China and approved by the Institutional Animal Care and Use Committee of Jiangsu University (permit number: SYXK2018-053).
Four-week-old BALB/c mice were used (body weight ~ 20 g) for the experiments in vivo. Ten mice were randomly divided into two groups with 5 mice in each group. The brief surgical procedure was as follow: Firstly, the mice were anaesthetized with 10% chloral hydrate in normal saline by intraperitoneal injection at 3.5 ml per kg body weight. Their fur on the skull surface was shaved off using an electric razor and this area was sterilized with Iodine. Then, a 1.5 cm long longitudinal skin incision was made on the mouse scalp from the back of the eyes to the skull area using a sterile scalpel. The fascia was stripped laterally to expose the skull. Next, a 5 mm diameter defect was made using an electric drived low-speed (about 1500 rpm) trephine bur on one side of the parietal bone and cooled with normal saline during the whole process. Finally, 20 µL of Ca/P-CDs loaded F127 hydrogel (100 µg/mL) was injected into the calvarial defect. After the surgery, the wound was sutured with simple interrupted suture and then the mice were placed separately and fed normally. CT images of the calvarial defect were acquired on a clinical 64-slice multidetector CT scanner (SOMATOM Emotion, Siemens, Bavaria, Munich, Germany). After 8 weeks, the major organs (heart, liver, spleen, kidneys, and lungs) were collected for conventional histocompability analysis.
3.0 Statistical Analysis
All experimental data were presented as mean ± standard deviation (SD) and analyzed by one-way analysis of variance (ANOVA) or Tukey’s multiple comparison tests between different treatments. P < 0.05 was considered statistically significant.