Reagents and antibodies
DMEM high sugar medium (Gibco, #11965092), Penicillin-Streptomycin (Gibco, #15070063),fetal bovine serum (FBS,Gibco, #10099133),Tissue ROS detection kit (Beibo Biological,#BB-470532,), cell reactive oxygen detection kit( Biyuntian,#S0033S), cell apoptosis detection kit (KGI Bio, #KGA108-1), CCK8 reagent (Dongren Chemical, #CK04), superoxide Substance detection kit (Biyuntian,S0060), autophagy staining detection kit (Solebao, #G0170-100T), Lyso-Tracker Red(Solebao,#L8010-50μl); Goat Anti-Rabbit IgG H&L (HRP)(Jackson,#111-035-003),Beclin-1 (D40C5) Rabbit mAb(CST,#3495T), mTOR (7C10) Rabbit mAb(CST, #2983T), Phospho-mTOR (Ser2448) (D9C2) Rabbit(CST, #5536T), LC3A/B (D3U4C) XP® Rabbit mAb(CST,#12741T), Cleaved Caspase-3 (Asp175) Antibody(CST, #9661T), 3-MA(MCE, #HY-19312), Endonuclease SgrAI(NEB, #R0603S), Endonuclease EcoRI(NEB, #R3101V).
Detection of clinical specimens
A total of 10 normal rotator cuff tissues (5 males and 5 females) and 10 injured rotator cuff tissues (5 males and 5 females) of clinical rotator cuff injuries were taken, and divide them into male control group and male injury rotator cuff group,the female control group and female injury rotator cuff group, and arthroscopic rotator cuff repairs were performed.The protocol for collecting normal and injured tendon tissues during the operation and obtaining tendon samples has been approved by the Research Ethics Committee of the Third Affiliated Hospital of Guangzhou University of Chinese Medicine (Guangzhou, China), and an informed consent form has been signed. This study was registered with the China Clinical Trial Registry, registration number ChiCTR-2000033948. There were no differences in clinical characteristics between the groups of patients, including age, body mass index, gender, diabetes, hypertension, and peripheral arterial disease. All treated tendon tissues are frozen using liquid nitrogen and then ground. The ROS detection kit (Bebo, BB-470532) was used to detect the level of ROS in the tissue, and the tissue superoxide anion detection kit (GENME, GMS10096.2 v.A) was used to detect the level of superoxide anion (SOD) in the tissue. Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, USA). qPCR detection of Beclin1 and mTOR expression levels. WB detects Beclin1, p-mTOR/mTOR protein expression. The primers used are shown in Table 1, and the expression of Beclin1, mTOR, and GAPDH are used as endogenous controls. All experiments were repeated three times, and the data was calculated using the 2-ΔΔCt method.
TABLE 1 Primers used for quantitative real-time polymerase chain reaction
Gene
|
primers(5’-3’)
|
Amplicon size (bp)
|
h-GAPDH
|
Forward:
|
CAAGAGCACAAGAGGAAGAGAG
|
102
|
Reverse:
|
CTACATGGCAACTGTGAGGAG
|
h-Beclin1
|
Forward:
|
TCCATGCTCTGGCCAATAAG
|
111
|
Reverse:
|
ACGGCAGCTCCTTAGATTTG
|
h-mTOR
|
Forward:
|
GGTCGTGGAGAACATGGATTAG
|
91
|
Reverse:
|
ACCAGTGAGGTCTTGGGATA
|
Beclin1 shRNA lentivirus packaging and verification
According to the shRNA design rules, the target interference sequence of Beclin1 shRNA was designed: sh-Beclin1 F: 5’-CCGGCGGACAGTTTGGCACAATCAACTCGAGTTGATTGTGCCAAACTGTCCGTTTTTG-3’,Sh-Beclin1 R: 5’-AATTCAAAAACGGACAGTTTGGCACAATCAACTCGAGTTGATTGAGCCAAACTGACCG-3’, and EcoR Ⅰ and SgrA Ⅰ restriction sites were added to the shRNA end. The designed shRNA sequence was synthesized by Guangzhou Aiji Biosciences. Surgical repair of the remaining human tendon tissue, the third generation of vigorously growing human tendon stem cells were digested and counted, and the human tendon stem cells were infected with the recombinant lentivirus pLKO.1-shBeclin1. 72 hours after the recombinant pLKO.1-shBeclin1 was infected with TSCs, divided into blank group, NC-shRNA group, Beclin1 shRNA lentivirus group, the cells were collected and total RNA was extracted. The changes in Beclin1 mRNA were detected by qPCR. The RNA extraction and qPCR detection methods were the same as before; the cells were collected and the protein was extracted. WB was used to detect the changes in Beclin1 expression, protein extraction and The WB detection method is the same as before. All experiments were repeated three times.
The effect of H2O2 on the proliferation of human TSCs cells
Collect human TSCs cells in logarithmic growth phase, count them, resuspend the cells in DMEM high glucose complete medium, adjust the cell concentration to 1×105 cells/ml, inoculate the 96-well plate, add 0.1 ml cell suspension to each well, and keep at 37 ℃ , Incubate overnight under 5% CO2 conditions. Discard the old culture medium in the culture well, add 0.1 ml of DMEM high glucose complete medium containing 0, 0.05, 0.1, 0.2, 0.4 mM H2O2, and continue the culture at 37 ℃, 5% CO2. After culturing for 24, 48, 72 hours, discard the medium in the well, add 0.1ml DMEM high glucose complete medium containing 10% CCK8, incubate for 2~3 hours at 37℃, 5% CO2, and measure OD450 on the microplate reader. And draw the cell growth curve. CCK-8 detects the effect of H2O2 on the proliferation of human TSCs. All experiments were repeated three times.
The mechanism of H202 on autophagy of human TSCs
Collect human TSCs cells in logarithmic growth phase, count them, resuspend the cells in DMEM high glucose complete medium, adjust the cell concentration to 1×105 cells/ml, inoculate the 6-well plate, add 2 ml cell suspension to each well at 37 ℃ , Incubate overnight under 5% CO2 conditions. Discard the old medium in the wells, and process them in groups as follows: blank group: add 2 ml of fresh DMEM high sugar complete medium; H2O2 intervention group: add 2 ml of DMEM high sugar complete medium containing 0.05 mM H2O2; 3-MA pretreatment Treatment group: Add 2 ml of DMEM high glycosyl complete medium containing 5 mM 3-MA for 30 min, discard the medium, and add 2 ml of DMEM high glycosyl complete medium containing 0.05 mM H2O2. Autophagy staining (MDC), autophagy-lysosomal staining (Lyso-Tracker Red) and transmission electron microscopy were used to observe autophagy, immunofluorescence staining to detect the expression of autophagy factor LC3A/B; DCFH-DA to detect cellular reactive oxygen species ROS level, Annexin V/PI detection of cell apoptosis; WB detection of Beclin1, mTOR, p-mTOR (Ser2448), LC3A/B, cleaved caspase-3 protein expression. The protein extraction and WB detection methods are the same as before. All experiments were repeated three times.
Statistical Analysis
SPSS 20.0 software was used for statistical analysis. Mean±SD was used to represent measurement data. All data were tested for normality and homogeneity of variance. The comparison between groups was tested by t, and the non-parametric test was used when the analysis of variance was not satisfied. The detection level was α= 0.05, P<0.05, the difference is statistically significant.