Diet and experimental setup
A total plant-based diet either with (experimental) or without (control) different prebiotics was prepared. The formulation and proximate composition of the diet is given in table 1 and supplementary table 1, respectively. The diets were prepared to meet the nutritional requirements of the rainbow trout [61] and manufactured and tested at the INRAE experimental fish farm in Landes, France. The diets were isoproteic (~50% crude protein), isolipidic (~20% crude fat) and isoenergetic (~24 KJ-g dry matter). The experimental diet was supplemented with either fructo-oligosaccharides (FOS), inulin or mannan-oligosaccharides (MOS), each at 2 different doses, 1g-100g and 2g-100g feed. These doses were selected based on previous studies on various carnivorous teleosts [13]. The basal diet contained only the mixture of plant ingredients and vegetable oils supplemented by free amino acids. Thirty-six juvenile rainbow trout (~0.13g-L) in equal numbers of males and females were randomly distributed in each of the 130 L fiberglass tanks. There were seven diet groups in total and 3 tanks were assigned to each of the diet groups. The fish were kept throughout the experimental period under standard rearing conditions with water oxygen levels 9 mg-L, temperature 17 °C and pH 7.5, water flow rate 0.3L-s, with daylight of 12h and 12h of darkness. The fish were manually fed twice a day (with an interval of 8h) either with the control diet or one of the experimental diets for 12 weeks. The tanks were checked for mortalities (if any) daily. The fish were weighed in bulk every three weeks to evaluate the growth parameters.
Sampling
After the feeding experiment, fish were randomly sampled from each tank 24 h after the last feeding. The randomly selected fish were first anaesthetised with benzocaine (30 mg-L) before being euthanized with a benzocaine overdose of 100 mg-L, followed by blood collection for plasma isolation. After the blood collection, fish were aseptically dissected and the digestive tract was separated. Liver, adipose and muscle were dissected and immediately frozen with liquid nitrogen and stored at -80 °C for long-term storage. The posterior intestine was separated from the rest of the digestive tract and was cut open longitudinally using sterile instruments. The posterior intestine was chosen because most polysaccharide-utilizing bacteria are found in the distal intestine of other animals. The contents and mucus were sampled together to analyse the total microbial profile of the intestine and a part of the tissue was also collected for the RNA extraction. Intestinal contents and distal intestinal tissue samples for SCFA and electron microscopy, respectively, were also flash frozen using liquid nitrogen and then stored at -80 °C.
Diet and whole-body proximate composition
Proximate composition was performed by the following methods. Dry matter was determined by drying the samples at 105 °C for 24 h. The weight of the post-dried samples was subtracted from the pre-dried samples. Ash content in the samples was measured by incinerating the samples at 550 °C for 16 h and comparing the weight of post-incinerated samples with the weight of the pre-incinerated samples. Protein content and lipid content were measured by the Kjeldahl and Kjeltek™ methods, respectively. The gross energy of the samples was measured using an adiabatic bomb calorimeter (IKA, Heitersheim Gribheimer, Germany).
Measurement of the plasma biochemical parameters
Blood samples were collected using the heparinised syringe and tubes. Samples were centrifuged at 3000 g for 10 min to isolate plasma and stored at -20°C until use. Commercial kits designed to be used along with the microplate reader were used to measure the plasma glucose (Glucose RTU, bioMérieux, Marcy l’Etoile, France), triglycerides (PAP 150, bioMérieux), cholesterol (Cholesterol RTU, bioMérieux) and free fatty acid (NEFA C kit, Wako Chemicals, Neuss, Germany). Total free amino acid was quantified according to the method of Moore [62], with glycine as standard.
Hepatic fat measurement
Hepatic fat was measured according to the protocol described previously [63]. The lyophilised liver samples (100mg) were mixed and homogenised with Folch reagent to extract the lipids. The lipids were extracted three times using this protocol and sodium chloride was added to the recovered supernatant after centrifugation for phase separation. The bottom layer containing the lipids was harvested and transferred to a glass tube, and the solvents were evaporated using nitrogen gas at 40°C. After drying, the lipids were weighed.
Hepatic glycogen measurement
Liver glycogen was measured according to the protocol described by Good et al [64]. Briefly, lyophilised liver (100 mg) was homogenised with 1M HCL (VWR, France). After this step, the samples were divided into 2 aliquots and one part was neutralised with 5M KOH (VWR), centrifuged and the supernatant was used to measure free glucose with a commercial kit (Glucose RTU, bioMérieux). The second aliquot was boiled with 5M KOH (VWR) for 2.5h at 100°C before neutralization. After centrifugation, total glucose (free glucose + glucose released by hydrolysis of glycogen) was measured in the supernatant. The glycogen content was calculated by subtracting the free glucose from the total glucose.
Microbiome analysis
DNA extraction
DNA from the mixture of intestinal contents and mucus was extracted using the QIAamp fast DNA stool kit (Qiagen, France) according to the manufacturer’s instructions with the following modifications. Samples were mixed with Inhibitex buffer (1:7 ratio) and homogenized using zirconia beads (1.4 mm) in a 2-mL tube with a tissue homogenizer, Precellys®24 (Bertin technologies, Montigny le Bretonneux, France) at 5000 rpm for 30 sec. After homogenization, samples were incubated at 70 °C for 10 min instead of 1 min. These two modifications were performed for efficient lysis of cells that are difficult to lyse. DNA was checked for purity and integrity, and then quantified using NanoDrop 2000c (Thermo, Vantaa, Finland).
Generation of the 16s rRNA sequencing libraries
Libraries were prepared according to the standard protocol recommended by Illumina® [65]. The gene-specific region of the primer targeted the V3 and V4 regions of the 16s rRNA gene [66]. The illumina adapter overhang sequence was appended to the gene-specific region. The preparation of the amplicon sequencing library involved 2 stages of PCR. The first stage of PCR was a 25 µL reaction mixture consisting of 12.5 µL KAPA HiFi Mastermix (Roche, France), 5 µL (1µM) each of the forward (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGAC
AGCCTACGGGNGGCWGCAG-3’) and reverse (5’-GTCTCGTGGGCTCGGAGATGT
GTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) primers and 2.5 µL of DNA (~100 ng). Reactions were performed in duplicate for each sample. Thermocycling conditions included a pre-incubation for 3 min at 95 °C, followed by 35 cycles of denaturation at 95 °C for 30 sec, annealing at 55 °C for 30 sec, and extension at 72 °C for 30 sec. A final extension was performed at 72 °C for 5 min. The resulting PCR products were pooled for each sample and run on a gel to confirm amplification of a ~550 bp product. A positive and a negative control sample were also included in the run. After confirmation of PCR amplification, the PCR products were shipped to La Plateforme Génome Transcriptome de Bordeaux (PGTB, Bordeaux, France) for the following steps. Index PCR was performed to add the unique dual indexes to the sequences in a sample-specific manner. For this purpose, the Nextera XT index kit was used according to the manufacturer’s protocol (Illumina, France). Thermocycling conditions were the same as in step 1, except that PCR was performed for only 8 cycles. After PCR clean-up, libraries were quantified using the KAPA library quantification kit for Illumina platforms (Roche, France) according to the manufacturer’s instructions. Libraries were pooled at an equimolar concentration (4nM) and sequenced on a MiSeq platform using a 250 bp Paired End Sequencing Kit v2 (Illumina, France).
PCR conditions and sequencing protocol were also the same for Firmicutes amplicons using forward (5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGCAGCAGTRGGGAATCTTC3’) and reverse (5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACACYTAGYACTCATCGTTT3’) primers.
Data analysis
The initial data analysis was performed using the UPARSE pipeline [67]. First, the forward and reverse reads of each sample were fused. Also, the primer binding sites were removed from the assembled sequences. Then, the sequences were quality filtered using the strategy of filtering by the maximum expected error rate [68]. Sequences with an error rate of > 0.01 per sequence were removed from the dataset. After quality filtering, sequences from different samples were labelled with the sample name and combined in to a single file. This collection of sequences was dereplicated and the sequences that were observed only once in the dataset (singletons) were removed, as these singletons were most likely sequencing artefacts [69]. The sequences were further clustered into OTU (Operational Taxonomic Unit) based on a sequence similarity of 97%. The raw reads were then mapped back to the OTUs to obtain the abundance of each OTU in different samples. The taxonomy was assigned to the OTUs using SINTAX [70]. Taxonomies with bootstrap confidence value less than 0.8 were removed from the dataset. Furthermore, OTUs belonging to the phylum Chloroflexi were removed from the analysis as it is likely that these OTUs originated from the plant components of the diet. A phylogenetic tree in Newick format was constructed based on the OTU sequences. The OTU table, taxonomy table and phylogenetic tree were imported into the phyloseq package [71] in R (version 3.6.3) along with the sample metadata. Alpha diversity measures, observed OTUs and Shannon index [72] were calculated. Beta diversity was calculated using the Bray-Curtis distance with the phyloseq package. All of these data analysis steps were also applied to the Firmicutes amplicon dataset.
Short-chain fatty acid measurement
Sample preparation
Frozen samples of intestinal contents were weighed and placed in 1-L glass bottles (Duran, Mainz, Germany) filled with clean air zero supplied by an F-DGS air zero generator (Evry, France). Screw caps with three GL14 ports (Duran) were used to connect the bottles directly to the heated inlet line (100 °C) of the SIFT-MS instrument via the sample inlet. A Tedlar bag (Zefon International Inc., Florida, USA), filled with dry and clean zero air and connected to the bottle inlet was used to compensate for the depression in the bottle during SIFT-MS sampling at a flow rate of 20 mL min-1 [73,74]. The closed bottle was incubated at 60 °C ± 2 for 2 hours before SIFT-MS analysis.
Selected Ion Flow Tube – Mass Spectrometry (SIFT-MS) measurements
A Voice 200 Ultra SIFT-MS (SYFT Technologies, Christchurch, New Zealand) equipped with a dual source generating positive soft ionizing reagent ions (H3O+, O2●+, NO+) with the nitrogen carrier gas (Air Liquid, Alphagaz 2) was used in this study.
Full-scan mass spectra were recorded for each positive precursor ion (H3O+, O2●+, NO+) in a m/z range from 15 to 250 with an integration time of 60 s. Quantification was performed using the NO+ precursor ion. In SIFT-MS analysis, quantification is straightforward and requires only measurement of the count rate of the precursor ion [R] and product ions [P]. The analyte concentration in the flow tube [A] can be determined according to the following calculation:
where tr is the reaction time in the flow tube and k is the apparent reaction rate constant.
Electron microscopy
Electron microscopic studies were performed at the Bordeaux Imaging Center - Bordeaux University, a Core facility of the French network “France Bio Imaging”. Intestinal samples were fixed with 2.5% (v/v) glutaraldehyde in 0.1M phosphate buffer (pH 7.4) for at least 2h at room temperature (RT) and stored at 4 °C until further processing. Samples were washed in 0.1M phosphate buffer and post-fixed in 1% (v/v) osmium tetroxide in 0.1M phosphate buffer for 2h in the dark (RT), followed by washing in water. Dehydration (by a series of graded ethanol) and embedding preparations in epoxy resin (Epon 812; Delta Microscopy, Toulouse, France) were performed automatically using the automatic microwave tissue processor for electron microscopy (Leica EM AMW; Leica Microsystems, Vienna, Austria). Polymerization of the resin was carried out at 60 °C for a period of 24-48 hours. Samples were then sectioned using a diamond knife (Diatome, Biel-Bienne, Switzerland) on an ultramicrotome (EM UCT, Leica Microsystems, Vienna, Austria). Thick sections (500 nm) were prepared with toluidin blue staining to localize the region of interest. Then, ultrathin sections (70 nm) were picked up on copper grids and subsequently stained with uranyless and lead citrate. The grids were examined with a transmission electron microscope (H7650, Hitachi, Tokyo, Japan) at 80kV.
Gene expression analysis
RNA from liver, intestine and muscle was extracted using TRIzol reagent method (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. RNA from adipose tissue was extracted using the RNeasy kit for fatty tissues (Qiagen, France). One µg RNA was converted to cDNA using the enzyme superscript III reverse transcriptase and random hexamers (Invitrogen, France) in the case of liver and muscle, while the quantinova reverse transcription kit (Qiagen, France) was used for adipose tissue and intestine. After the reverse transcription, cDNA was diluted 75-fold(liver) and 20-fold for muscle, adipose tissue and intestine before its use in RT-qPCR.
RT-qPCR was performed on a LightCycler® 384 system (Roche Diagnostics, Neuilly-sur-Seine, France). Reactions were performed on a 384 well plate. The total volume of reaction was 6 µL, consisting of 3 µL of LightCycler® SYBR Green I Master mix (Roche, France), 0.24 µL each of the forward and reverse primers at 200 nM, and 2 µL of cDNA diluted in DNAse/RNAse-free water (5 Prime GmbH, Hamburg, Germany). Thermocycling conditions included a pre-incubation at 95 °C for 10 min, followed by 45 cycles of denaturation at 98 °C for 15 sec, annealing at 60 °C for 10 sec and extension at 72 °C for 15 sec. Fluorescence data were recorded after each cycle at 72 °C. A melt curve analysis was performed to check the specificity of the primers. The Cq values were further converted to relative quantities considering the efficiency of each primer pair used in the study. The list of genes and details of the primers are shown in supplementary table 2. Relative quantities of each gene were then normalized against the normalization factors calculated for each tissue based on the geometric mean of the relative quantities of the 2 most stable reference genes across samples. These calculations were performed using geNorm [75], which is implemented in the R [76] package SLqPCR [77]. The reference genes eef1a and rna18s were used to calculate the normalization factor in liver, while a combination of actb and eef1a was used in muscle, actb and eef1a in adipose tissue, and actb and rna18s in intestine. Normalized relative quantities were analysed for statistical significance.
Statistical analysis
Zootechnical parameters, including feed efficiency (FE) and specific growth rate (SGR), are calculated per tank (n=3). HSI, VSI and final growth data are collected for each sampled individual (n=9). Samples from the same nine fish were also used for gene expression analysis and plasma parameters. For microbiome analysis, three fish were sampled in addition to the 9 already mentioned. Three additional fish per group were sampled for SCFA analysis and for electron microscopy.
All statistical analysis was performed using R software (version 3.6.3) [76]. Data were tested for normality of distribution and homogeneity of variance using the Shapiro-Wilk test and Bartlett’s test, respectively. If these two assumptions were met, the data were analysed using one-way ANOVA followed by Tukey’s HSD as a post hoc test. If the data were not normally distributed, Levene’s test for homogeneity of variance was used. When variables did not follow either of the assumptions of normal distribution or equal variance, a non-parametric Kruskal-Wallis test followed by a pairwise Wilcoxson test was used.
Multivariate homogeneity of group dispersions (variances), as proposed in PERMDISP2 [78], was analysed using the ‘betadisper’ function in the vegan package [79]. The statistical significance of Bray-Curtis distances between dietary groups was analysed using permutational multivariate analysis of variance: PERMANOVA [80], as implemented in the ‘pairwise_adonis’ function of the ranacapa package [81]. Firmicutes data were analysed following the same steps. In addition, differences in community composition were analysed and visualised using supervised partial least square discriminant analysis (PLS-DA) as implemented in the mixOmics package [82]. The rCCA (regularised canonical correlation analysis) function of the same package was used to calculate the correlations between OTUs and hepatic gene expression, zootechnical and plasma parameters. Zero inflated OTU data were transformed using centered log transformation (clr).