Animals
Male Wistar rats weighing 180-220 were purchased from the animal house of Shahid Bahonar University of Kerman. They were housed under 12 h light/dark cycle and at 22±2°C temperature and were ad libitum for food and water intakes. For adapting to the new environment, the experiments were done after one week. All experiments were reviewed and approved by the animal ethical committee of the Shahid Bahonar University of Kerman (Approval No. IR.KMU.REC. 1399. 096), which complies with the ARRIVE guidelines (Kilkenny et al. 2010).
Drugs
Salicylic acid (Molekula, England), Ketamine hydrochloride (Bremer Pharma GMBH, Germany), and diazepam (Caspian Pharmaceutical Co, Iran) were used in this study. For diluting (SA), it was dissolved in DMSO and alcohol and then diluted with normal saline. The ratio of normal saline to DMSO and alcohol was (3:1:1) (v/v).
Experimental design to evaluate the anxiolytic effect of salicylic acid
Animals were randomly divided into seven groups (n=6). The Control group received the solvent, and the 5 salicylic acid treated groups were injected with 0.1, 1, 10, 30, and 300 mg/kg of it. The name of each group was according to the dose received. One group received diazepam (3mg/kg) as the reference drug. The drugs were administered intraperitoneally (i.p) 30 min before placing the rats in the elevated plus maze. All rats were suffered from 2 hours of isolation before placing in the maze (fear potentiated plus maze test). It should be mentioned that rats were transferred and habituated to the testing room for 24h before the test.
Elevated plus maze
Elevated plus maze is a method for the measurement of anxiety in rodents. It is consisted of two open arms (50 cm × 10 cm×2.5 cm) and two closed arms (50 cm × 10 cm × 20 cm), extending from a central platform (10 cm × 10 cm). The open arms are perpendicular to the closed ones. The central square and the arms are located 50 cm above the floor. Rats were placed individually on the center of the maze, facing to open arms and then allowed to explore freely for 5 min (Lister 1987; Pellow et al. 1985). The percentage of entry into and time spent in the open arms (OAE% and OAT%, respectively) were calculated using a video tracking and image processing software (Maze router software,Technic azma, Iran).
Experimental design to evaluate the hypnotic effect of salicylic acid
Ketamine (100 mg/kg, i.p.) was used to induce sleep in rats (Douglas and Dagirmanjian 1975). Rats in different groups (n=6) were pre-treated with the solvent, salicylic acid with 3 different doses of (10,30,300 mg/kg), and diazepam (3 mg/kg), 30 min before the administration of ketamine. Each animal was observed for sleep latency (SL) or the onset of sleep (time from injection of ketamine to time of loss of righting reflex) and the duration of sleep or total sleeping time (TST) i.e., the time from loss to regain of consciousness.
Experimental design for detecting the effect of salicylic acid on hippocampal GAD67 gene expression in the fear potentiated plus maze test
After fear potentiated plus maze test animals were euthanized in a CO2 chamber. The ventral part of the hippocampus from each rat brain, were dissected and transferred to the liquid nitrogen and then stored in a -80°C freezer. All the control, diazepam, and also the specimens from the SA treated groups which showed the anxiolytic effects, were chosen for evaluating (GAD67) gene expression with the reverse transcription-quantitative polymerase chain reaction technique (n=6).
Reverse transcription-quantitative polymerase chain reaction (RTqPCR)
Total RNA from each group was extracted with an RNA isolation kit (DENAzist Asia, Iran). The quantity of total RNA was calculated with a NanoDrop spectrophotometer (Thermo Scientific, USA) and agarose gel electrophoresis. The RNA templates were used for cDNA synthetizing by adding random hexamer and dNTP mix according to the manufacturing company (Pars tous, Iran). QPCR master mix (Pars tous, Iran) were added and prepared for PCR running with SYBR green reporter dye. Samples were run three times on PCR light cycler Roche (Roche life Science, Germany) and the gene expression data were analyzed via its software version1.1. The program of the real time apparatus for the genes was: 95°C for 8 min followed by 40 cycles of 95°C for 30 s, 60°C for 30s, and 72°C for 30 s. Samples were normalized with the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The sequences of primers used are as follows: GAD67: forward CACAGAGACGGACTTCTCCA; reverse AACTGCACAGTTTGCTCCTC, GAPDH: forward CAAGGCTGAGAATGGGAAGC; reverse GAAGACGCCAGTAGACTCCA.
To determine the relative gene expression ratio, the ΔΔCT mathematical model was applied, and 2−ΔΔCT was carried out for statistical analysis of relative gene expression (Schmittgen and Livak 2008).
Statistical Analysis
The behavioral tests and the RTqPCR dataset were analyzed by SPSS statistics 26 software (Chicago, USA) and the significant differences between groups of the study were detected by one-way analysis of variance (ANOVA) followed by the Duncan’s post hoc test. All data were presented as mean ± SEM and values of p< 0.05 were considered statistically significant.