Cell culture and treatment
MCF-7 (estrogen-receptor positive) and MDA-MB-231 (triple-negative) breast cancer cells were obtained from American Type Culture Collection (ATCC) (Manassas, VA, USA). Cells were grown in Dulbecco's Modified Eagle Medium (DMEM) (11965-118, Life Technologies, Carlsbad, CA, USA) which contained 10% fetal bovine serum (FBS, 10437-028, Thermo Fisher Scientific, Waltham, MA, USA) and 1% penicillin streptomycin, at 37°C in 5% CO2 incubator. Cells between passages 10 and 15 were used for the experiments. For treatment purposes, MCF-7 and MB-231 cells were serum starved for twelve hours with DMEM without FBS and Penicillin Streptomycin. 70-80% confluent cells were treated with 2 and 5μM parthenolide (PTL) (Parthenolide, Item No 70080, Cayman Chemical Company, Ann Arbor, MI, USA) and untreated (control) for 24 hours using DMEM media with 0.5% FBS. Cells were harvested post treatment for RNA isolation and Western Blot Analysis. Key proteins and genes were analyzed by Western blot and qRT-PCR respectively.
MTT assay
Cell proliferation/viability were measured using the 3-(4,5-dimethy lthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay kit (k299-1000, BioVision Inc., Milpitas, CA, USA). Cells were seeded at 1× 104 cells/well in 96-well plates and treated (2 µM or 5 µM) and untreated (control) PTL for 24 hours. After 24 hours of treatment, the medium was discarded and 50 µl of serum free medium and 50 µl of MTT reagent were added into each well. For background control, 50 µl of MTT reagent were added into a well containing medium only. Plates were incubated at 5% CO2 and at 37ºC temperature for 3 hours. After incubation, 150 µl of MTT solvent was added into each well. The plate was wrapped in aluminum foil, shaken on a shaker for 15 minutes, and then the absorbance was taken at 590 nm wavelength and proliferation was measured using the data of three independent experiments as previously described [17].
Monolayer wound scratch assay
MCF-7 and MDA-MB-231 cells were plated at 5× 105 cells/well in 12-well plates. After reaching total confluence, a “scratch” was created using a 10 µl pipette tip by scraping the monolayer in a neat, straight line. The previous media was discarded, cells were washed with Dulbecco’s phosphate buffered saline (DPBS, 1 ml for each well) and treated with and without PTL (2 and 5µM) for 24 hours. Wounds were imaged every 10 min for 24 hours, using a Nikon Eclipse motorized microscope with incubator at 5% CO2 and 37ºC temperature (Nikon Instruments Inc., Melville, NY, USA). The initial and the final wound widths were measured and the migration speed was calculated by taking the difference of the initial and final wound width and dividing them by the total elapsed time [18].
Apoptosis analysis
To detect apoptosis, MCF-7 and MBA-231 cells were plated at 5× 105 cells/well in a 12 well plate until sub-confluent. Then the cells were treated with and without parthenolide (2 and 5 µM) for 24 hours. After 24 hours, the medium was removed from the wells and 100 µl annexin V binding buffer was added along with the stain fluorochrome conjugated annexin V (5 µl) using the FITC Annexin V Apoptosis Detection Kit I (BD Biosciences, San Jose, CA, USA) following manufacturer’s protocol. Then the cells were incubated for 15 minutes at room temperature and the plate was wrapped with foil for protection from light. The cells were washed again and resuspended with 200 µl binding buffer and analyzed using a Nikon Eclipse motorized microscope with incubator (Nikon Instruments Inc., Melville, NY, USA).
Cytosolic fraction preparation
Cells were plated at 1× 106 cells/well in 6 cm plates until sub-confluent, then treated with and without PTL (2 and 5 µM) for 24 hours. After that, the medium was removed from the wells and washed with cold DPBS (2ml/plate). Then the cell lysate was collected using a scrapper after adding 75µl of Buffer A (10 mM HEPES, pH 7.5, 10 mM KCL, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 1mM PMSF, 2 µg/ml each of aprotonin and leupeptin). It was then centrifuged at 12,000 ×g for 1 minute. The supernatant cytoplasmic extracts were saved. Protein concentration was measured with a protein assay kit (Bio-Rad, Hercules, CA, USA).
Western-blot analysis
Equal amount of proteins (40-60 µg) were separated by electrophoresis on 12% SDS PAGE gels and transferred to PVDF membranes. Membranes were blocked using protein-free Tween 20 blocking buffer (37571, Thermo Scientific) for one hour, and probed using primary and secondary antibodies as described before [19, 20]. The primary antibodies used for the study are vimentin (DSHB, University of Iowa, Iwoa City, USA, dilution 1:300) and E-cadherin (701134, Thermo Fisher, dilution 1:200), TGF-β (sc-146, Santa Cruz Biotechnology, Inc., Dallas, TX, USA, dilution 1:300). The secondary antibodies used were (anti-rabbit 0711-625-152, or anti-mouse 115-625-146, 1:5000 dilution, Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). Membranes were scanned and bands quantified using the Odyssey infrared Imaging System (LiCor Biosciences, Lincoln, NE, USA).
Gene expression by quantitative real-time PCR (qRT-PCR)
Both MCF-7 and MBA-231 cells were serum starved for 12 hours with DMEM without FBS and Penicillin Streptomycin and, when the cells were 70-80% confluent, treated with PTL 2 and 5 μM for 24 hours. Total RNA was isolated from treated MCF-7 cells (plated at 5× 105 cells/well in 6-well plates) using the Qiagen RNeasy Plus kit (74136, Qiagen, Germantown, MD, USA). Reverse transcription was performed using total RNA with the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). qPCR was performed using primer sets (Sigma-Aldrich, St. Louis, MO, USA) for genes of interest and reference gene and iQ SYBR Supermix (Bio-Rad) following manufacturer's protocol. Total RNA isolation, reverse transcription, and quantitative real-time PCR (qPCR) were performed as previously described [21]. RNA expression data were normalized to levels of reference gene GAPDH using the comparative threshold cycle method.
The primer sequences used are:
Human GAPDH: F- AGCCTCAAGATCATCAGCAATGCC
Human GAPDH: R- TGTGGTCATGAGTCCTTCCACGAT
Human TWIST1: F- GCACCATCCTCACACCTCT
Human TWIST1: R- CTGATTGGCACGACCTCTTG
Human SNAIL1: F- TCGCTGCCAATGCTCATC
Human SNAIL1: R-GGAAGAGACTGAAGTAGAGGAGAA
Human TGFβ: F- GGCCCTGCCCCTACATTT
Human TGFβ: R- CCGGGTTATGCTGGTTGTACA
F; Forward, R; Reverse
Statistical analysis
Statistical comparisons between groups were made either using Student's t-test, or one-way ANOVA. All values are reported as mean ± SEM. Differences were considered to be statistically significant at P values of 0.05 or less.