The Monocyte Chemotactic Protein 1 as a Potential Indicator for SARS-CoV-2 Infected Mild COVID-19 Patients&nbsp;

doi:10.21203/rs.3.rs-71401/v1

Download PDF

Research

The Monocyte Chemotactic Protein 1 as a Potential Indicator for SARS-CoV-2 Infected Mild COVID-19 Patients

https://doi.org/10.21203/rs.3.rs-71401/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 07 Jan, 2021

Read the published version in Virology Journal →

You are reading this older preprint version

Read the latest preprint version →

Background: The level of chemokine was markedly elevated in severe COVID-19 patients. But the role of chemokine in mild COVID-19 patients has not yet established. However, most of the COVID-19 patients in Shiyan City, China had mild cases.

Methods: In this study, the level of chemokine in the serum for COVID-19 patients in Shiyan City was detected by ELISA. The expression of receptor of chemokine and other signal molecular was detected by real-time PCR.

Results: We first demonstrated that COVID-19 patients are characterized by higher levels of chemokine. In particular, monocyte chemotactic protein 1 (MCP-1) has shown higher expression in patients with mild cases of COVID-19. The receptor of MCP-1, CCR2 was then found higher expression in the same mild COVID-19 patients. Finally, the higher expression of MCP-1 in mild COVID-19 patients is correlated with the inhibition of IFN signaling.

Conclusion: These findings add to our understanding of the immune-pathologic mechanisms of SARS-CoV-2 infection, and provide potential therapeutic targets and strategies. MCP-1 may be an effective indicator in mild patients, and early use of interferon has a good antiviral therapeutic effect.

Virology

COVID-19

Chemokine

MCP-1

IFN signaling

Mild

SARS-CoV-2 is the known coronavirus after severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV). It was first identified in late December 2019 and causes severe respiratory syndrome in humans^{1, 2}. The disease caused by SARS-CoV-2 has been recently named COVID-19 by the World Health Organization (WHO). Globally, as of August 2020, there have been 24,854,140 confirmed cases of COVID-19, including 838,924 deaths. According to the epidemiological statistics, most of the COVID-19 patients (about 80%) belong to the mild patients^{3, 4}. The city of Shiyan is located in Hubei Province, and most of the COVID-19 patients there had mild cases. For this reason, it is necessary to study the immunological characteristics of mild COVID-19 patients and find a suitable therapeutic strategy to prevent the transformation of mild to severe patients.

Inflammation is the body’s first line of defense against viral infection. It involves activating both the innate and adaptive immune responses. However, excessive immune responses after infection, also called a cytokine storms, have been found to be associated with extreme levels of pro-inflammatory cytokines and widespread tissue damage.

Preliminary studies have shown that SARS-CoV-2 infection triggers a cytokine storm, and results in the increase of a variety of cytokines, including chemokine^5–7. Chemokines are low-molecular-weight proteins with powerful chemoattractant activity. They play a role in the immune cell recruitment during inflammation. Chemokines are classified according to their chemical structure, the C, CC CXC and CX3C families⁸. The binding of chemokines to their receptors is responsible for their chemoattractant ability. The chemokine receptors are seven-transmembrane-spanning, G-protein-coupled receptors. They are expressed on leukocytes and endothelial cells, etc.⁹. Serum chemokine levels were found to be elevated in patients with COVID-19, and they were even higher in those who required ICU admission, suggesting a relationship with lung damage and disease severity¹⁰. However, it is not clear whether the concentration of chemokines is higher in mild COVID-19 patients, and the highly expressed chemokines can be used as a marker of the diagnosis and prognosis of mild COVID-19 patients.

Type I interferons have broad-spectrum antiviral activities against RNA viruses, which act by inducing an antiviral response and mediating adaptive immune response. Type I interferons include IFN-α and IFN-β¹¹. Infection of cells with virus causes the activation of several cellular transcription factors, such as interferon regulatory factor 3/7 (IRF3/7) and NF-kB, which activate the expression of a number of interferon-stimulated genes (ISGs) and exert antiviral effect^12,13. The downstream signaling pathway of the transcription factors can recruit and coordinate specific subsets of leukocytes, which is orchestrated primarily by chemokine secretion^14,15. This means that the secretion of chemokines may be related to the release of interferon, but the specific relationship between them in the process of SARS-CoV-2 infection has not been clearly established.

Clinically, Type I IFNs have already been approved for use in the treatment of certain cancers, autoimmune disorders, and viral infections¹⁶. Type I IFNs are currently in clinical trials to evaluate their ability to treat MERS-CoV and therefore have been proposed for the treatment of COVID-19, but there is currently no evidence from laboratory testing against SARS-CoV-2¹⁷.

In this study, we first demonstrated that COVID-19 patients are characterized by higher levels of chemokine. In particular, MCP-1 has shown higher expression in patients with mild cases of COVID-19 in Shiyan City. The receptor of MCP-1, CCR2 was then found higher expression in the Peripheral blood mononuclear cells (PBMCs) from same mild COVID-19 patients. Finally, mild COVID-19 patients are found to have lower levels of IFN-β in the serum. The higher expression of MCP-1 in mild COVID-19 patients is correlated with the inhibition of IRF3. Our results suggested that MCP-1 may be an effective indicator in mild patients, and interferon was a good antiviral therapeutic agent for mild COVID-19 diseases.

Mild COVID-19 patients have higher levels of MCP-1

According to the basic information of severe COVID-19 and mild COVID-19 patients in Table 1, it was suggested that there were no remarkable differences between them from hospital time and some complications. In order to further clarify the different role of chemokine in severe and mild COVID-19 patients, we detect three chemokine (including MCP-1, IP-10, and IL-8) in the serum among either severe or mild COVID-19 patients and healthy controls. It was demonstrated that MCP-1 upregulation was observed in almost all COVID-19 patients no matter what is severe or mild cases (Fig. 1A) (P < 0.01). In particular, MCP-1 has also shown higher expression in patients with mild cases of COVID-19. IP-10 showed upregulation in severe COVID-19 patients while no change in mild patients (Fig. 1B). Meanwhile, severe COVID-19 patients also showed the upregulation of IL-8 (Fig. 1C). Recent reports indicated that MCP-1, IP-10, and IL-8 levels were higher in COVID-19 patients and even higher among those admitted to ICU¹⁰. We also found that the level of expression of the three chemokine was increased in severe COVID-19 patients. It has been suggested that chemokines may play an important role in patients with severe COVID-19. The upregulation of MCP-1 in mild COVID-19 suggested that it may play the role in pathogenesis of mild diseases.

Table 1

Clinical characteristics of COVID-19 patients and healthy controls
Features	Severe COVID-19	Mild COVID-19	Healthy controls
Mean Age (year)	56.3	44.6	42
Gender (Female/Male)	30%	40%	40%
Average time of hospital (day)	28.4	23.4	-
Diabetes	20%	16.7%	-
Heart disease	20%	20%	-
Hypertension	40%	23.3%	-
Cancer	0%	0%	-
According to China National Health Commission Guidelines for Diagnosis and Treatment of SARS-CoV-2 infections (seventh version) issued by 2020.

Table 2

The primer sequence
	Gene Name	Primer sequence
1	CCR2	Up: 5’- AAGAGGCATAGGGCAGTGAG − 3’
1	CCR2	Down: 5’- GGGATTGATGCAGCAGTGAG − 3’
2	CXCR2	Up: 5’- GCATCAGTGTGGACCGTTAC − 3’
2	CXCR2	Down: 5’- GGCTGGGCTAACATTGGATG − 3’
3	CXCR3	Up: 5’- TGGTGGACATCCTCATGGAC − 3’
3	CXCR3	Down: 5’- CAAGAGCAGCATCCACATCC − 3’
4	IRF3	Up: 5’- GACCCTCACGACCCACATAA − 3’
4	IRF3	Down: 5’- CAGAAGTACTGCCTCCACCA − 3’

CCR2 show greater expression in PBMC from mild COVID-19 patients

Chemokines, when combined with corresponding receptors, play a chemotactic role in immune cells. In order to further clarify the role of chemokine in mild COVID-19 diseases, we tested the receptors for MCP-1, IP-10, and IL-8, respectively. The expression level of the receptor of MCP-1, C-C motif receptor 2 (CCR2); the receptor of IP-10, chemokine (C-X-C motif) receptor 3 (CXCR3); and the receptor of IL-8, CXCR2 were assessed in the PBMC from mild COVID-19 patients and healthy controls. We observed the upregulation of CCR2 (Fig. 2A) (P < 0.01), while there was no change of CXCR3 (Fig. 2B) and CXCR2 (Fig. 2C) between mild COVID-19 patients and healthy controls. It was demonstrated that MCP-1 may participate in the pathogenesis of mild COVID-19 diseases by binding its receptor.

Higher expression of MCP-1 in mild COVID-19 patients is correlated with the inhibition of IFN signaling

Transcriptional activation of interferon regulator factors (IRFs) results in the launch of general antiviral programs. We then explored the expression levels of IRF3 in mild COVID-19 patients. The expression of IRF3, an important gene in the interferon signaling pathway, was down-regulated (Fig. 3A) (P < 0.01). Meanwhile, the downregulation of IFN-β was observed in mild COVID-19 patients (Fig. 3B) (P < 0.01). To clarify the relationship between serum MCP-1 and expression level of IRF3, we performed Spearman rank correlation analysis, the results showed that IRF3 downregulation was significantly negative correlated with MCP-1 (Fig. 3C) (P < 0.01, r² = 0.861). Our results suggest that MCP-1 may be an effective index for mild COVID-19 patients, and interferon was a good antiviral therapeutic agent for mild COVID-19 diseases.

Previous studies have shown that elevated levels of pro-inflammatory cytokines, such as IFN-γ, TNF-α, IL-6 and IL-8, are associated with severe lung injury and adverse outcomes of SARS-CoV or MERS-CoV infection^18–20. It has also demonstrated that severe COVID-19 patients have higher concentrations of chemokine in the serum than mild cases, suggesting that the magnitude of cytokine storm is associated with the disease severity^{7, 9}.

Most of COVID-19 patients in Shiyan city are mild cases. In order to further study the level of chemokines in mild COVID-19 patients, we detected the level of chemokines in the serum of mild COVID-19 patients admitted to Xiyuan Hospital and Renmin Hospital in Shiyan City. We selected monocyte chemokine, MCP-1, interferon induced protein 10, IP-10 and neutrophil chemokine, IL-8. MCP-1, this protein belongs to the C-C chemokine family and is a powerful monocyte chemotactic factor that is constitutively produced or induced by oxidative stress, cytokines, or growth factors. Monocytes and macrophages are the main source of MCP-1, which regulates the migration and infiltration of monocytes, memory T cells, and NK cells²¹. Huang et al. found that MCP-1 levels were higher in patients with COVID-19 and even higher among those admitted to ICU¹⁰. It has been reported that MCP-1 increases rapidly in the early acute phase of infection and then progressively decreases with the advance of the disease²². Xiong et al. detected elevated levels of MCP-1 in the bronchoalveolar lavage fluid of patients with COVID- 19 and found it to be associated with the pathogeny of the virus²³. Elevated levels of MCP-1 have also been detected in the lung tissue of patients infected with SARS-CoV-2²⁴. IP-10 was initially identified as a chemokine whose secretion is induced by IFN-γ. IP-10 is secreted by neutrophils, endothelial cells, keratinocytes, fibroblasts, dendritic cells, astrocytes, and hepatocytes. Through its binding to chemokine receptor 3 (CXCR3), it regulates immune system responses by activating and recruiting leukocytes, including T cells, monocytes, and NK cells. Therefore, IP-10 and CXCR3 play a key role in recruiting leukocytes to inflamed tissues and in perpetuating inflammation, thereby making a major contribution to tissue damage²⁵. Serum IP-10 levels were found to be elevated in patients with COVID-19 and they have been found to be even higher in those who required ICU admission, suggesting a relationship with lung damage and disease severity¹⁰. Liu et al. associated elevated serum IP-10 levels with a higher viral load and greater lung damage in patients with SARS-CoV-2²⁶. Recent reports suggested that the expression level of IL-8 was higher in patients with severe COVID-19¹⁰. Our results also proved that MCP-1, IP-10 and IL-8 were up-regulated in severe COVID-19 patients (Fig. 1). It has been suggested that chemokines may play an important role in patients with severe COVID-19. In particular, MCP-1 has shown higher expression in patients with mild cases of COVID-19 (Fig. 1A). IP-10 and IL-8 showed upregulation in severe COVID-19 patients while no change in mild patients (Fig. 1B, 1C).

In order to further clarify the role of chemokine in mild COVID-19 diseases, we tested the receptors for MCP-1, IP-10, and IL-8²⁷, respectively. Between mild COVID-19 patients and healthy controls, CCR2 was up-regulated (Fig. 2A) (p < 0.01), while CXCR3 (Fig. 2B) and CXCR2 (Fig. 2C) did not change. It was demonstrated that MCP-1 may participate in the pathogenesis of mild COVID-19 diseases by binding its receptor.

Engagement of virus-specific RNA structures culminates in oligomerization of these receptors and activation of downstream transcription factors, most notably interferon regulator factors (IRFs) and nuclear factor kB (NF-kB). We found that, in mild COVID-19 patients with higher level of MCP-1, the expression of IRF3, an important gene in the interferon signaling pathway, was down-regulated (Fig. 3A). IFN-β levels in serum of peripheral blood from COVID-19 patients were lower than that of healthy controls (Fig. 3B). Meanwhile, IRF3 downregulation was significantly negative correlated with MCP-1 (Fig. 3C). Other studies have already established that SARS-CoV-2 has greater sensitivity to IFN-I than SARS-CoV²⁸. In these studies, pre-treatment with IFN-α or IFN-β drastically reduced viral titers. These findings suggest that IFN-I may be effective as a prophylactic agent or an early treatment option for SARS-CoV-2. However, delayed IFN administration was of no benefit over a placebo²⁹. Channappavanar et al. showed that delayed IFN-I expression can be detrimental in mice in the context of SARS-CoV-1 infection³⁰. The timing of interferon exposition may be critical for controlling the virus and avoiding immunopathogenesis. Early administration of IFN was slightly beneficial to reducing viral load and improving clinical outcome in COVID-19 patients.

In summary, our results suggested that inhibition of interferon signaling pathway may be an effective mechanism of viral immune escape, and interferon supplementation may be a useful therapeutic strategy for mild COVID-19 patients.

SARS-CoV: severe acute respiratory syndrome coronavirus; MERS-CoV: Middle East respiratory syndrome coronavirus; WHO: World Health Organization; IRF3/7: interferon regulatory factor 3/7; PBMCs: Peripheral blood mononuclear cells; ELISA: Enzyme linked immunosorbent assay; MCP-1: monocyte chemotactic protein 1; IP-10, Interferon-inducible protein-10; CCR2: C-C motif receptor 2; CXCR: chemokine (C-X-C motif) receptor.

Ethics approval and consent to participate: The study protocol received approval from the Clinical Ethics Committee of Hubei University of Medicine (2020-TH-017). All individuals gave their informed consent to participate.

Consent for publication: Not applicable.

Availability of data and materials: All data generated or analysed during this study are included in this published article.

Competing interests: The authors declare that they have no competing interests.

Funding: This work was supported by Emergency Research Project for COVID-19 of Shiyan City (20Y01). Emergency Research Project for COVID-19 of Hubei University of Medicine (2020XGFYZR02, 2020XGFYZR03). The Principal Grant of Hubei University of Medicine (HBMUPI201804). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Author Contributions: Conceived and designed the experiments: XX YW. Performed the experiments: XX, YG, MZ. Analyzed the data: XX BD, YW. Contributed reagents/materials/analysis tools: YW, GL. Wrote the paper: XX, BD.

Acknowledgements: Not applicable

Subjects.

The diagnose of COVID-19 was graded according to China National Health Commission Guidelines for Diagnosis and Treatment of SARS-CoV-2 infection (seventh version). 10 severe and 30 mild COVID-19 patients were recruited from Xiyuan Hospital and Renmin Hospital, Shiyan City and the study protocol received approval from the Clinical Ethics Committee of Hubei University of Medicine (2020-TH-017). Another 10 healthy subjects were recruited as a control group. All individuals gave their informed consent to participate. The basic information of COVID-19 patients and healthy controls is listed in Table 1.

Isolation of Peripheral blood mononuclear cells (PBMCs)

PBMCs were isolated through density-gradient centrifugation using Ficoll-Paque (Sigma, 17144002) from peripheral blood samples of the participants in this study. Isolated PBMCs were cultured in the presence of RPMI 1640 medium (supplemented with 10% fetal bovine serum) at 37°C in an incubator with 5% CO₂.

Real-time PCR

After RNA was isolated from PBMCs, it was reverse transcribed into cDNA. Real-time quantitative PCR was performed to quantify chemokine receptors and transcript factor and GAPDH levels by using SYBR Premix Ex Taq (TaKaRa, RR820A) in the Bio-rad CFX manager 3.1 software. The primer sequences were listed in Table 2.

Enzyme linked immunosorbent assay (ELISA)

The chemokine monocyte chemotactic protein 1 (MCP-1), Interferon-inducible protein-10 (IP-10), Interluekin 8 (IL-8) and interferon β (IFN-β) in the serum of COVID-19 patients and healthy controls were determined by ELISA kit according to the manufacturer’s instruction (1117392, 1110802, 1117452, Dakewei.Inc, KE00187, Sanying. Inc.).

Statistical analysis

Analysis of Variance (ANOVA) tests were used to compare the plasma chemokine levels among the COVID-19 patients and healthy control groups. The Spearman rank correlation coefficient was used for linear correlation analysis between the expression level of plasma chemokine and IRF3. All data were analyzed using SPSS version 19.0 and GraphPad 5.0 software. P value less than 0.05 was considered statistically significant.

Shanmugaraj B, Malla A, Phoolcharoen W. Emergence of Novel Coronavirus 2019-nCoV: Need for Rapid Vaccine and Biologics Development. Pathogens, 2020, 9(2).
Malik YS, Sircar S, Bhat S, et al. Emerging novel coronavirus (2019-nCoV)-current scenario, evolutionary perspective based on genome analysis and recent developments. Vet Q. 2020;40(1):68–76.
Tian S, Hu N, Lou J, et al. Characteristics of COVID-19 infection in Beijing. J Infect. 2020;80(4):401–6.
Wang Y, Wang Y, Chen Y, et al. Unique epidemiological and clinical features of the emerging 2019 novel coronavirus pneumonia (COVID-19) implicate special control measures. J Med Virol. 2020;92(6):568–76.
Wang D, Hu B, Hu C, et al. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA, 2020.
Chen N, Zhou M, Dong X, et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study. Lancet. 2020;395(10223):507–13.
Chen G, Wu D, Guo W, et al. Clinical and immunological features of severe and moderate coronavirus disease 2019. J Clin Invest. 2020;130(5):2620–9.
Bacon K, Baggiolini M, Broxmeyer H, et al. Chemokine/chemokine receptor nomenclature. J Interferon Cytokine Res. 2002;22(10):1067–8.
Bachelerie F, Ben-Baruch A, Burkhardt AM, et al. International Union of Basic and Clinical Pharmacology. [corrected]. LXXXIX. Update on the extended family of chemokine receptors and introducing a new nomenclature for atypical chemokine receptors. Pharmacol Rev. 2014;66(1):1–79.
Huang C, Wang Y, Li X, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395(10223):497–506.
Pestka S, Krause CD, Walter MR. Interferons, interferon-like cytokines, and their receptors. Immunol Rev. 2004;202:8–32.
Schoggins JW, Wilson SJ, Panis M, et al. A diverse range of gene products are effectors of the type I interferon antiviral response. Nature. 2011;472(7344):481–5.
Lazear HM, Schoggins JW, Diamond MS. Shared and Distinct Functions of Type I and Type III Interferons. Immunity. 2019;50(4):907–23.
Proudfoot AE. Chemokine receptors: multifaceted therapeutic targets. Nat Rev Immunol. 2002;2(2):106–15.
Sokol CL, Luster AD. The chemokine system in innate immunity. Cold Spring Harb Perspect Biol, 2015, 7(5).
Garcia-Sastre A, Biron CA. Type 1 interferons and the virus-host relationship: a lesson in detente. Science. 2006;312(5775):879–82.
Sallard E, Lescure FX, Yazdanpanah Y, et al. Type 1 interferons as a potential treatment against COVID-19. Antiviral Res. 2020;178:104791.
Chien JY, Hsueh PR, Cheng WC, et al. Temporal changes in cytokine/chemokine profiles and pulmonary involvement in severe acute respiratory syndrome. Respirology. 2006;11(6):715–22.
Chu H, Zhou J, Wong BH, et al. Productive replication of Middle East respiratory syndrome coronavirus in monocyte-derived dendritic cells modulates innate immune response. Virology, 2014, 454–455: 197–205.
Kong SL, Chui P, Lim B, et al. Elucidating the molecular physiopathology of acute respiratory distress syndrome in severe acute respiratory syndrome patients. Virus Res. 2009;145(2):260–9.
Deshmane SL, Kremlev S, Amini S, et al. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res. 2009;29(6):313–26.
Lin L, Lu L, Cao W, et al. Hypothesis for potential pathogenesis of SARS-CoV-2 infection-a review of immune changes in patients with viral pneumonia. Emerg Microbes Infect. 2020;9(1):727–32.
Xiong Y, Liu Y, Cao L, et al. Transcriptomic characteristics of bronchoalveolar lavage fluid and peripheral blood mononuclear cells in COVID-19 patients. Emerg Microbes Infect. 2020;9(1):761–70.
Chu H, Chan JF, Wang Y, et al. Comparative replication and immune activation profiles of SARS-CoV-2 and SARS-CoV in human lungs: an ex vivo study with implications for the pathogenesis of COVID-19. Clin Infect Dis, 2020.
Ruffilli I, Ferrari SM, Colaci M, et al. IP-10 in autoimmune thyroiditis. Horm Metab Res. 2014;46(9):597–602.
Liu Y, Zhang C, Huang F, et al. Elevated plasma levels of selective cytokines in COVID-19 patients reflect viral load and lung injury. National Science Review. 2020;7(6):1003–11.
Acosta JC, O'Loghlen A, Banito A, et al. Chemokine signaling via the CXCR2 receptor reinforces senescence. Cell. 2008;133(6):1006–18.
Mantlo E, Bukreyeva N, Maruyama J, et al. Antiviral activities of type I interferons to SARS-CoV-2 infection. Antiviral Res. 2020;179:104811.
Omrani AS, Saad MM, Baig K, et al. Ribavirin and interferon alfa-2a for severe Middle East respiratory syndrome coronavirus infection: a retrospective cohort study. Lancet Infect Dis. 2014;14(11):1090–5.
Channappanavar R, Fehr AR, Vijay R, et al. Dysregulated Type I Interferon and Inflammatory Monocyte-Macrophage Responses Cause Lethal Pneumonia in SARS-CoV-Infected Mice. Cell Host Microbe. 2016;19(2):181–93.

Download PDF

Journal Publication

published 07 Jan, 2021

Read the published version in Virology Journal →

Review #1 received at journal
17 Sep, 2020
Editorial decision: Major revision
17 Sep, 2020
Reviewer #5 agreed at journal
14 Sep, 2020
Reviewer #4 agreed at journal
11 Sep, 2020
Review #3 received at journal
11 Sep, 2020
Review #2 received at journal
11 Sep, 2020
Reviewer #3 agreed at journal
10 Sep, 2020
Editor assigned by journal
09 Sep, 2020
Reviewers invited by journal
09 Sep, 2020
Reviewer #1 agreed at journal
09 Sep, 2020
Reviewer #2 agreed at journal
09 Sep, 2020
First submitted to journal
08 Sep, 2020
Submission checks completed at journal
08 Sep, 2020
Editor invited by journal
08 Sep, 2020

You are reading this older preprint version

Read the latest preprint version →

The Monocyte Chemotactic Protein 1 as a Potential Indicator for SARS-CoV-2 Infected Mild COVID-19 Patients

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Mild COVID-19 patients have higher levels of MCP-1

CCR2 show greater expression in PBMC from mild COVID-19 patients

Discussion

Conclusions

Abbreviations

Declarations

Materials And Methods

References

Status:

Journal Publication

Version 1