Cell culture. Rat L6 myoblasts were purchased from the Japanese Collection of Research Bioresources (JCRB) Cell Bank (JCRB9081, National Institutes of Biomedical Innovation, Health and Nutrition, Osaka, Japan). L6 myoblasts were seeded in 6-well plates and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Thermo Fisher Scientific, Inc., Tokyo, Japan) supplemented with 10% fetal bovine serum (Equitech-Bio, Inc., TX, USA), 1% penicillin-streptomycin solution (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan), and incubated at 37 °C and 5% CO2. After the cells reached 80–90% confluency, the myoblasts were differentiated into myotubes with DMEM supplemented with 2% horse serum for 5–7 days. To generate medium- or high-phosphate conditions, 0.1 mol/L NaH2PO4 and Na2HPO4 were added in equal amounts to the DMEM supplemented with 2% horse serum to obtain a final PO43− concentration of 2.45 mmol/L (MPi) or 3.8 mmol/L (HPi).
Following the completion of the 10-day culture period with 2% horse serum-supplemented DMEM (CON), MPi, or HPi, the myotubes were washed twice in calcium- and magnesium-free Hanks’ balanced salt solution (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) and used for the following measurements.
Western blot analysis. Myotubes in 6-well plates were lysed with M-PER™ Mammalian Protein Extraction Reagent (Thermo Fisher Scientific, Inc., Tokyo, Japan) and sonicated to extract all proteins. The Western blot procedure was previously described [12]. Briefly, protein concentrations were quantified using a commercial reagent (Pierce BCA Protein Assay Kit; Pierce, IL, USA) and normalized to 1 µg/µL for all samples. A total of 5 or 15 µg of protein was loaded into each lane of a 5–20% precast e-PAGEL (ATTO Co., Tokyo, Japan). The gel was transferred to a polyvinylidene difluoride (PVDF) membrane using Ezblot (AE-1460, ATTO, Tokyo, Japan) reagent and a semi-dry blotting unit (WSE-4110 PoweredBLOT One, ATTO, Tokyo, Japan) according to the manufacturers’ instructions. After transfer, the blots were blocked with a commercial blocking reagent (Can Get Signal PVDF Blocking Reagent; Toyobo, Osaka, Japan) for 1 h at room temperature. After washing in Tris-buffered saline (50 mM Tris, 150 mM NaCl; pH 7.6) containing 0.1% Tween 20 (TBST), the blots were incubated overnight at 4 °C with primary antibodies diluted in an immunoreaction-enhancer solution (Can Get Signal Solution 1; Toyobo). The primary antibodies used in this study were rabbit polyclonal anti-GAPDH (sc-25778; Santa Cruz Biotechnology, CA, USA; diluted 1:1500), rabbit polyclonal anti-caspase-3 (#9662S, Cell Signaling Technology, MA, USA; diluted 1:1000), rabbit polyclonal anti-cleaved caspase-3 (#9661S, Cell Signaling Technology, MA, USA; diluted 1:1000), mouse monoclonal anti-myostatin (GDF-8/11(A-1), sc-398333; Santa Cruz Biotechnology, CA, USA; diluted 1:1000), mouse monoclonal anti-p70 S6 kinase (sc-8418; Santa Cruz Biotechnology, CA, USA; diluted 1:1000), mouse monoclonal anti-p-p70 S6 kinase (sc-8416; Santa Cruz Biotechnology, CA, USA; diluted 1:1000), and mouse monoclonal anti-human myosin heavy chain (MHC, MAB4470; R&D Systems, MN, USA; diluted 1:2000). The membrane was washed in TBST and then reacted with a horseradish peroxidase-conjugated donkey anti-rabbit IgG secondary antibody (ab16284; Abcam, Cambridge, MA, USA) diluted in an immunoreaction-enhancer solution (1:5000 in Can Get Signal Solution 2; Toyobo, Osaka, Japan) for 1 h at room temperature. The membrane was washed in TBST and processed using an enhanced chemiluminescence reagent (ECL Prime Western Blotting Detection Reagent; GE Healthcare Japan, Tokyo, Japan). The ECL signals on the immunoblots were detected using the WSE-6100 LuminoGraph (ATTO, Tokyo, Japan) and quantified using ImageJ software (version 1.47; National Institutes of Health, Bethesda, MD, USA).
RNA isolation and RT-qPCR analysis. Total RNA was extracted from L6 myotubes using TRIzol reagent (Thermo Fisher Scientific, Inc., Tokyo, Japan) according to the manufacturers’ instruction. To quantify mRNA expression levels, the following primers were used: Myod1 (Fw; CGGGACACAGACTTGCTAGG, Rv; GTGAGTCGAAACACGGATCA), Myog (Fw; TCGAGGCTCTGAAGAGAAGC, Rv; AGGCGCTCAATGTACTGGAT), and 18S rRNA (Fw; AAACGGCTACCACATCCAAG, Rv; CGAAGAGCCCGGTATTGTTA). cDNA was synthesized with a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Inc., Tokyo, Japan). qPCR was performed using the Power SYBR™ Green PCR Master Mix (Thermo Fisher Scientific, Inc., Tokyo, Japan) and analyzed with the 7500 Real-Time PCR System (Thermo Fisher Scientific, Inc., Tokyo, Japan). Relative mRNA expression levels were calculated using the 2−ΔΔCT method to normalize target gene mRNA to 18S rRNA.
Statistical analysis. All data are presented as the mean ± s.d. The statistical significance among three phosphate conditions (Fig. 1) or between two unpaired groups (Fig. 2–4) were analyzed by one-way ANOVA or a two-tailed Student’s t-test, respectively. P < 0.05 was considered to be statistically significant.