PDLSCs culture
Human PDLSCs were isolated and cultured to 3–5 passages as previously described. (39) The Ethics Committee of Nanjing Medical University School of Stomatology (NJMU-2018202) approved the study. The primary PDLSCs were isolated by trypsin digestion. The lysed tissue was evenly inoculated into a 6cm dish and then cultured in α-minimum primary medium (α-MEM, GIBCO, life technologies, Ma, USA), which 10% fetal bovine serum (FBS, hyclone, USA), 100 µL/ml streptomycins and 100 U/ml penicillin were added. After 24 hours, the medium was changed with a fresh medium containing 10% fetal bovine serum. Take the primary passage cells in the logarithmic growth phase and adjust the cell density to 10–15 cells/ml. Cells were placed in a 37°C, 5% CO2 incubator. After culturing in a 96-well culture plate for 12 hours, single-cell wells were labelled. After five days, the medium was changed to observe the formation of a single clone, and the cells from a single cell were expanded to more than 107. Follow-up experiments collect 3–5 generations of PDLSCs. The cells were cultured in a hypoxic incubator (Thermo Scientific™ Heracell VIOS 150i, USA), containing 2% O2, 5% CO2, 92% N2, at a temperature of 37°C, and cultured for several days according to experimental design.
Adipogenic differentiation
PDLSCs were planted into 12-well plates, and when cell density reached 60–70%, adipogenic induction solution (Cyagen BioSciences Inc.) was added for culture. The plate was cultured in a 5% CO2 incubator at 37℃ and replaced with the induction medium every two days. After 28 days of adipogenic induction, 4% paraformaldehyde (PFA) fixed the cells for 30 minutes and applied Oil Red O to stain the cells at room temperature.
Chondrogenic differentiation
PDLSCs cultured in a medium dish were collected and placed in a 15mL centrifuge tube containing cartilage induction medium (Cyagen Biosciences Inc.) with the tube cap was gently loosened. The cell microspheres were cultured for 3–5 days in a 37°C, 5% CO2 incubator, then the cells were transferred into 24-well plates and cultured for 21 days. Chondroblast induction solution was changed every three days. The cell spheres were fixed, and frozen sections (5µm in thickness) were stained with alcian blue.
Plasmid construction and cell transfection
PDLSCs were transfected with miR-214-5p mimics (mimics, 50 nM), mimics negative control (NC, 50 nM), miR-214-5p inhibitor (inhibitor, 100 nM) and inhibitor negative control (iNC, 100 nM) respectively, with a fusion degree of 30%-50%. The transfection reagent is made with the Ribofect™CP Kit (RiboBio, Guangzhou, China). Similarly, PDLSCs transfected by NEAT1, SMAD4, HIF-1α knockout and negative controls (siNEAT1, siSMAD4, siHIF-1α, siNC, 100 nM) were transfected with the same reagents. By predicting binding sites, the luciferase reporter plasmids of Lnc NEAT1 and SMAD4 and miR-214-5p and Lnc NEAT1 were constructed. 293 T cells were transfected with Lipofectamine 2000 in a serum-free medium for 4–6 hours, and then the basal medium was swapped.
Cell proliferation assay
PDLSCs were resuspended and inoculated on 96-well plates (2×103 cells/well) in hypoxia or normoxia, respectively. Or transfection of miR-214-5p mimics (mimics, 50 nM) and mimics negative control (NC, 50 nM), miR-214-5p inhibitor (inhibitor, 100 nM) and inhibitor negative control (iNC, 100 nM). The same amount of 10% cell counting kit (CCK)-8 reagents were added to each well on 0, 1, 3, 5 and 7 days, and the cells were incubated for 2 hours under the same conditions. The absorbance was measured at 450nm with a microplate analyzer. Cell-Light™ EDU Apollo®567 In Vitro Imaging Kit (RiboBio) was adopted to detect EDU. The transfected PDLSCs were inoculated in 24-well plates. After incubated with reagent A for 5 hours, the cells were fixed and treated with one × Apollo® reaction solution for 30 minutes. The cells were perforated with 0.5% Triton X-100. The stained nuclei were then incubated with Hoechst 33342 for 30 minutes. After washing with PBS, the staining results were observed with a fluorescence microscope. The cell proliferation rate was calculated by ImageJ software.
Flow cytometry
When the transfected cells reached 80%, the cells were collected by EDTA-free trypsin (Beyotime, Haimen, China). Flow cytometry was applied to analyze the cell cycle phases (G0/G1, S and G2/M). After being gently washed twice in 0.01% phosphate-buffered saline (PBS) overnight, the cells were fixed with 75% precooled ethanol at 4°C. The proliferation index PI = G2M + S was used to analyze the results. PDLSCs were washed twice with 0.01 mol/L PBS and resuspend in 100 µL wash buffer to identify the cellular markers of PDLSCs phenotype. PDLSCs were incubated with primary antibodies (CD34, CD45, CD73, CD29, CD90, CD105) for flow cytometry analysis (BD Biosciences, CA, USA).
Quantitative real-time polymerase chain reaction (RT-PCR)
Total RNA of PDLSCs was extracted with Trizol reagent (Invitrogen, CA, USA). Reverse transcription of RNA was performed by reverse transcriptase. Random primers were used for mRNA and lncRNA, and stem ring primers were used for miRNA. CHAMQ Universal SYBR qPCR Master Mix (Vazyme) was used in ABI 7900 real-time PCR system (Applied Biosystems). Gene expression was normalized by GAPDH (mRNA, lncRNA) or U6 (miRNA) and calculated by 2−△△Ct. Each experiment was conducted three times independently. The list of primers is shown in Table 1.
Table 1
Sense and antisense primers for real-time reverse transcription PCR
Genes
|
Primers
|
Sequences (5′-3′)
|
GAPDH
|
Forward
|
TCACCAGGGCTGCCATCTGCTCTC
|
|
Reverse
|
TTGCAGTGGCAAAGTGGAGATTGTTG
|
COL1A
|
Forward
|
TCTGACTGGAAGAGCGGAGAG
|
|
Reverse
|
GAGTGGGGAACACACAGGTCT
|
COL3A
|
Forward
|
CTGTGAATCATGCCCTACTGGTC
|
|
Reverse
|
AAGCCTCTGTGTCCTTTCATACC
|
BSP
|
Forward
|
GAACCACTTCCCCACCTTTT
|
|
Reverse
|
ATTCTGACCATCATAGCCATCG
|
NEAT1
|
Forward
|
GGACAGTAAGCCGAGTGG
|
|
Reverse
|
AGGCAAGCAACACCGAT
|
CAP
|
Forward
|
CCTGGCTCACCTTCTACGAC
|
|
Reverse
|
CCTCAAGCAAGGCAAATGTC
|
CEMP1
|
Forward
|
GGCGATGCTCAACCTCTAAC
|
|
Reverse
|
GATACCCACCTCTGCCTTGA
|
SMAD4
|
Forward
|
CTCATGTGATCTATGCCCGTC
|
|
Reverse
|
AGGTGATACAACTCGTTCGTAGT
|
Lnc NEAT1
|
Forward
|
GGACAGTAAGCCGAGTGG
|
|
Reverse
|
AGGCAAGCAACACCGAT
|
Screening potential pathways involved in hypoxia-mediated cementogenic differentiation
Based on previous sequencing databases and bioinformatics analysis, enrichment analysis results of PDLSCs differentially expressed target genes in hypoxic microenvironment were screened, and possibly related GO term, and KEGG pathways were screened out.
Western blot analysis
Protein was extracted, protein concentration was determined, 10% SDS-PAGE gel was prepared, and protein samples were added. The proteins were separated by 60V constant pressure electrophoresis and transferred to the membrane at 300mA constant current (Millipore, MA, USA). The membrane was sealed with 5% BSA solution at room temperature for 2 hours. Then the membranes were added anti-HIF-1α (ABCAM, UK), RUNX2 (ABCAM, UK), OCN (ABCAM, UK), GAPDH (Proteintech, USA), COL1A (Proteintech, USA), COL3A (Proteintech, USA), BSP (Santa Cruz, USA), CAP (Santa Cruz, USA), CEMP1 (ABCAM, UK), SMAD3 (Cell Signaling Technology, USA), SMAD4 (Proteintech, USA) and SMAD5 (Proteintech, USA) primary antibodies. The protein bands were detected overnight at 4℃ and diluted at 1:1000. JV1.8.0 image was used for grey analysis.
Alkaline phosphatase (ALP) activity assay, alizarin red staining (ARS) and alcian blue staining (ABS)
The alkaline phosphatase assay kit (Jiancheng, Nanjing, China) was used to detect alkaline phosphatase activity. According to the protein concentration of PDLSCs on the seventh day, p-nitrobenzene phosphate was added according to the instructions, and the luminosity value at 405nm was measured to calculate the relative ALP activity. When the fusion degree of PDLSCs reached 70%, the cells were inoculated on a 12-well plate and cultured in an osteogenic induction medium containing 0.1mmol/L dexamethasone 50µL/L ascorbic acid and 10mmol/L β-glycerophosphate. After 7 or 14 days of induction, PDLSCs were fixed with 4% paraformaldehyde for 30 minutes and stained with alkaline phosphatase substrate (Beyotime, Shanghai, China) or alizarin red (40mM, pH = 4.2, Sigma, Aldrich). The cells were eluted with cetylpyridine chloride (100mM) for at least 1 hour, and the relative calcium mass was calculated according to the absorbance at 562nm. PDLSCs were induced by cementogenic differentiation in a 12-well plate for 21 days. Cleaning cell surface with PBS, the cells were fixed with methanol for 5 minutes, washed and dried. Alcian blue staining solution A (KeyGEN BioTECH, China) was added and stained for 30 minutes. After washed thoroughly and dried the cells. Alcian blue staining solution B was added for 10 minutes. Cells were washed, dried and observed under a light microscope.
Immunofluorescence staining
After three days of transfection and induction, PDLSCs were fixed with 4% paraformaldehyde. Triton X-100 (Beijing, China) was treated for 12 minutes and then blocked with goat serum at 37°C for 1.5 hours. SMAD4, SMAD5, CEMP1, COL3A or BSP primary antibodies were incubated overnight, and fluorescent secondary antibodies were incubated at room temperature and in the dark for 1.5 hours. DAPI (Beyotime, China) was used to stain the nuclei. Cells were then observed under a fluorescence microscope (Leica, Germany).
Nucleocytoplasmic separation
Paris ™Kit was used to extract cytoplasmic cytonuclear RNA. One hundred seven cells were treated with trypsin and centrifuged at low speed. After resuspended and cleaned with PBS, the supernatant was discarded. Resuspend the cells with 400 µL Cell Separation Buffer and incubate for 10 minutes. All experiments were carried out on the ice. After centrifugation at 500×g for 1 minute, the nuclear precipitation and cytoplasmic supernatant were obtained. Then, after the cytoplasmic supernatant was carefully sucked out, the nuclear residue was dissolved with a 400 µL precooled Cell Disruption Buffer. Afterwards, equal amounts of 2×Lysis/Binding Solution were added to the nuclear and cytoplasmic samples at room temperature and immediately and thoroughly mixed by flipping the tubes a few times or gently blowing them. The sample mixture was gently mixed with anhydrous ethanol and centrifuged for 1 minute to pass through the filter. Then, use Wash Solution 1 and 2/3 as instructed to complete the washing step. Finally, the RNA was dissolved in an eluent preheated to 95–100°C. Nuclear RNA and cytoplasmic RNA were collected for RT-PCR analysis.
Dual-luciferase reporter assay
HEK-293 T cells were seeded into a 96-well plate (1×105 cells/well). When cell density reached 80%, miR-214-5p and negative control were transfected into HEK-293 T cells on the next day, respectively. In the meantime, 100 ng Lnc NEAT1 or SMAD4 wild-type reporter plasmid and 20 ng Renilla luciferase (RL) reporter plasmid was co-transfected into HEK-293 T cells. Lnc NEAT1 or SMAD4 reported plasmid mutations were used as controls. A dual-luciferase reporter assay system (Promega, Madison, WI) was used to detect luciferase activity after 48 hours.
Statistical analysis
Quantitative data were presented as mean ± standard deviation of three independent records. SPSS17.0 software was used for statistical analysis. T-test or one-way analysis of variance was used to determine that the difference was statistically significant, and P < 0.05 was considered the standard.