Experimental Design
Five hCD46 IFNabR-/- (IFNARCD46tg) breeding pairs were received from Dr. André Lieber (University of Washington, Seattle). Both male and female hCD46 IFNabR-/- mice were used in this study. For the pregnant mouse model, hCD46 IFNabR-/- mice were housed individually in microisolator cages. 8 to 10 weeks-old C57BL/6 male mice were purchased from Charles River for the pregnant mouse model.
Immunizations were conducted by inoculating mice with vaccines in 100 μl via intraperitoneal (i.p) or intramuscular route (i.m., 50 μl into each gastrocnemius muscle). ZIKV challenges were performed by subcutaneous inoculation in the hind limb with 104 FFU of the mouse-adapted ZIKV African MR766 strain or 106 FFU of the ZIKV Asian (PRVABC59 strain) in 100 μl PBS in non-pregnant mice. For the pregnancy experiments, super-ovulation was induced as the hCD46 IFNabR-/- female mice produce 5-6 pups under normal breeding conditions. hCD46 IFNabR-/- female mice were i.p. injected with 5IU/mouse of pregnant mare serum gonadotropin (PMSG) on day 36 and 5IU/mouse of human chorionic gonadotropin (hCG) on day 38 to induce super-ovulation. Super-ovulated hCD46 IFNabR-/- females were mated with naive wild-type C57BL/6 male mice on day 38. Females were checked for plugs the next day (day 39) and weighed daily until the end of the experiment. At E10.5-11.5, C57BL/6 male mice were removed from the cage and pregnant dams (hCD46 IFNabR-/-) were inoculated with 102 FFU of the mouse-adapted ZIKV African MR766 strain by subcutaneous injection in the hind limb. Animals were sacrificed at E17.5-18.5, and placentas, fetuses, and maternal tissues were harvested. All African challenged mice were euthanized when ethically defined clinical endpoints were reached (hind-limb paralysis). Mice were randomly allocated to groups. All experiments had five mice per group, except for the pregnant mouse study. For the pregnant mouse study- 10 mice vaccinated, and 20 control animals were mated, wherein three vaccinated and three PBS mice and four PBS-mock challenged mice were impregnated.
Animals and care
This study was carried out in strict adherence to recommendations described in the Guide for the Care and Use of Laboratory Animals (39), as well as guidelines of the National Institutes of Health, the Office of Animal Welfare, and the United States Department of Agriculture. All animal work was approved by the Institutional Animal Care and Use Committee (IACUC) at Thomas Jefferson University (animal protocol 01155 and 01873). All procedures were carried out under isoflurane anesthesia by trained personnel under the supervision of veterinary staff. Mice were housed in cages, in groups of five, under controlled conditions of humidity, temperature, and light (12-h light/12-h dark cycles). Food and water were available ad libitum.
Cells
Vero-CCL81, Vero-E6, and 293T/T17 cells were purchased from ATCC and maintained in high glucose Dulbecco’s modified Eagle’s medium (DMEM, Corning, 10-017-CV) supplemented with 5% fetal bovine serum (FBS, R&D SYSTEMS, S11150) and 1% penicillin/streptomycin (P/S, Gibco, 15140122) and cultured at 37°C with 5% CO2.
Viruses
The following ATCC viral stocks were purchased for this study. Zika virus African MR766 strain (ATCC, VR-1838), Zika virus Asian PRVABC59 strain (ATCC, VR-1843), and measles virus low-passage Edmonston strain (ATCC, VR-24).
Antibodies
The following antibodies were used in this study: Anti-ZIKV-E mouse monoclonal antibody (Biofront Technologies, 1176-56), Pan-Flavivirus-E 4G2 mouse monoclonal antibody produced from hybridoma cell line D1-4G2-4-15 (ATCC, HB-112), Anti-Measles Nucleoprotein mouse monoclonal antibody produced from hybridoma NP.cl25 (Millipore Sigma, Cat # 95051114).
Recombinant MV-ZIKV vaccines plasmid construction
To generate the first-generation MV-ZIKV vaccines the codon optimized Zika prME gene (signal peptide= MR766 strain, GenBank: MK105975.1 and prME sequence= PRVABC59 Asian 2015; GenBank: KU501215.1; Supplemental Fig. S1) was synthesized by GenScript. PCR amplification of the coding region of Zika prME from the gene synthesized plasmid was performed using primers ZMP Fwd1 (5’- GTGTCGACGCGTGGAATCCTCCCGTACGGCCACCATGGGGGCTGATA
CAAGCATTGGCA - 3’) and ZMP Rev1 (5’- GTGTCGGACGTCATTTATGCGGACACTGCG
GTGGACAGAAAA-3’). PCR fragments were digested with the respective enzymes and ligated into the ATS-0 or ATS-2 MV vector to generate MV-E0 and MV-E2, respectively (JM109 E.coli). The MV virus (Edmonston B strain) vaccine vector expressing GFP at ATS-0 flanked by BsiWI, and AatII restriction sites were received from Dr. R. Cattaneo. This vector was modified to include a hammerhead ribozyme at the 5’ end (ATS-0 MV vector). A MV (Edmonston B strain) vaccine vector (ATS-2 MV vector) was generated to create an additional transcriptional site (ATS) by inserting MluI and AatII sites at ATS-2.
To generate the 2nd generation MV-ZIKV vaccines, the codon optimized Zika prME-NS1 gene (strain PRVABC59 Asian 2015; GenBank: KU501215.1; Supplemental Fig. S5) was synthesized by GenScript. PCR amplification of the coding region of Zika prME-NS1 from the gene synthesized plasmid was performed using primers MV-ZprME-NS1(2) Fwd (5’-ACAGAGTGATACGCGTACGGGCCACCATGGGGG-3’) and MV-ZprME-NS1(2) Rev (5’-GCACGCGATCGCAAGACGTCGGCTATGCTGTCACC-3’). PCR fragment was inserted into the ATS-2 MV vector to generate MV-E-NS1(2) by In-Fusion cloning (Stellar cells). An additional MV (Edmonston B strain) vaccine vector (ATS-6 MV vector) was generated to create an additional transcriptional site (ATS) by inserting MluI and SpeI sites at ATS-6. PCR amplification of the coding region of Zika prME-NS1 from the gene synthesized plasmid was performed using primers MV-coZprME-NS1(6) Fwd (5’-ACAGAGTGATACGCGTACGGGCCACCATGGGGGCTGA
TAC-3’) and MV-coZprME-NS1(6) Rev (5’- TCTATTTCACACTAGTGCGATCGCGACGTCG
GCTATGCTGTCACC-3’). The PCR fragment was digested and inserted into ATS-6 MV vector to generate MV-E-NS1(6). PCR amplification of the coding region of Zika prME-NS1 from the gene synthesized plasmid (Supplemental Fig. S6) was performed using primers MV-coNS1 Fwd 1 (5’- ACAGAGTGATACGCGTACGGGCCACCATGGAGACAGACACACTCCT-3’) and MV-coNS1 Rev 1 (5’- GCACGCGATCGCAAGACGTCGGCTATGCTGTCACCATAGAGCG
GACCAGGTTG-3’) was used to generate fragment 2. Fragment 2 was digested by restriction enzymes MluI, SgrAI. In order to insert the human IgKappa signal peptide at ATS-2 to allow for better secretion of ZIKV-NS1, fragment 1 was generated by PCR amplification using primers IgKappa Fwd 2 (5’-ACAGAGTGATACGCGTGGCCACCATGGAGACAGACACACTCCTGC
TATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACG-3’) and IgKappa Rev 2 (5’-ACACGAACACGCCGGTGCCACACCGTGTCTCCTTCTTAGAAAAATCCACGGAGCATCCCACGTCACCAGTGAACCTGGAACCCAGA-3’). The PCR fragments 1, and 2 were inserted into the ATS-2 MV vector to generate MV-NS1(2) by In-Fusion cloning (Stellar cells).
Virus recovery
293T/T17 cells (0.8 ´106 cells per well) were pre-seeded in 6 well plates. The MV-ZIKV viruses and control MV’s were rescued from their full-length cDNA with the helper-plasmid rescue system. 293T/T17 cells were transfected with pCAGGS-T7, pTIT-MVN (MV-Nucleoprotein), pTIT-MVP (MV-Phosphoprotein), and pEMC-MVLa (MV-Large protein), using the XtremeGene9 reagent (Millipore Sigma). After overnight incubation at 37°C, the cells were heat shocked at 42°C for 3 hours and then returned to 37°C. After 3 days of incubation at 37°C, transfected cells were transferred onto a monolayer of Vero cells and incubated at 37°C. Virus was harvested from Vero cells when syncytia involved 80% to 90% of the culture by scraping infected cells, freeze-thawing cells, and medium, and centrifuging them to remove cellular debris.
Virus production
The Measles viruses were grown in T175 flask with sub-confluent Vero cells in Optipro SFM. The medium was changed every 3-4 days, and supernatant was collected until the cell monolayer came-off. The low passage MV Edmonston strain (ATCC-VR 24) was propagated by inoculating 100 mL of the original ATCC vial into a T175 flask pre-seeded with Vero cells (80% confluent) in 32 mL of 1X DMEM (2% FBS) and placed 37°C in a humidified 5% CO2 atmosphere. The virus supernatant was harvested after 12 days. The virus was harvested by freeze-thawing cells and medium, centrifuging them at 3000 rpm for 10 minutes to remove cellular debris. Viral supernatants were tittered, aliquoted, and frozen at –80°C.
Zika viruses were grown in a T175 flask with sub-confluent Vero cells in 1X DMEM (2% FBS, 1% PS). The medium was changed every 3-4 days, and the supernatant was collected until the cell monolayer came-off. The harvested virus was tittered on Vero cells, and high titer stocks were aliquoted and frozen at –80°C
Virus titration
Measles virus titration: Measles virus titers were analyzed as 50% tissue culture infectious dose (TCID50) by the Reed–Muench method. 104 Vero cells in 100 mL per well were pre-seeded in a 96 well flat-bottom plate 2 hours before the addition of the virus to the well. 180mL of 1X DMEM (Corning, Cat# 10-017-CV) was added to every well of the 96 well round bottom plate (dilution plate). 20 mL of one virus was added to Column 1 of the dilution plate. Twelve 10-fold serial dilutions of the virus were performed in the dilution plate in a total volume of 200 mL per well. 30mL of the diluted virus was transferred from one row to each row of the 96 well plates pre-seeded with cells, changing tips between each row. Two plates were prepared per inoculum. Plates were incubated at 37°C for 4 days. On day 4, plates were fixed with 80% Acetone for 10 mins at 4°C. The fixation solution was aspirated, and plates were allowed to air dry. Cells were blocked for 1hour in FACS buffer and stained with 100mL of Anti MV-N cl25 mouse monoclonal antibody (2 mg/mL in FACS buffer-1X PBS, 10%FBS, 0.05% Sodium azide) for 2 hours. Plates were washed 3X with FACS buffer and stained with secondary antibody, Cy3-conjugated Goat Anti-mouse IgG (2 mg/mL in FACS buffer) for 2 hours. After 3X washes with FACS buffer and plates were read using a fluorescence microscope. The TCID50 titer was calculated with the following formula:
Where L is the reciprocal of the last dilution in which all well is positive, d is the log10 of dilution factor, v is the volume of inoculum (ml/well).
Zika virus titration: ZIKV stocks were propagated in Vero cells or C6/36 cells and titrated by focus-forming assay (FFA) as described previously (64). Briefly, ten-fold serial dilutions of ZIKV in 1X DMEM (Corning, Cat# 10-017-CV) supplemented with 2% fetal bovine serum (R&D systems, Cat# S11150) and 20U/mL Penicillin-Streptomycin (Gibco, Cat# 1540122) were performed in 96-well Costar (Corning, NY) plates. 2.5´ 104 Vero or C6/36 cells per well were added to the 96 well plate incubated undisturbed for 3 days at 37°C. Media overlay was aspirated, and the cell monolayer was fixed with 80% Acetone for 10 minutes at 4°C. The fixation solution was aspirated, and plates were allowed to air dry. Cells were blocked for 1hour in FACS buffer and stained with Pan-Flavivirus E mouse monoclonal (1 mg/mL in FACS buffer) for 2 hours. Cells were then washed 3X with FACS buffer and stained with secondary antibody, Cy3-conjugated Goat Anti-mouse IgG (Jackson ImmunoResearch, 2 mg/mL in FACS buffer) for 2 hours. After 3X washes with FACS buffer and plates were read using a fluorescence microscope. For each sample, a dilution with easily distinguished foci is selected, and titer is calculated in focus-forming units per ml (FFU/ml), using the average of triplicate wells:
Multi-step growth curve
We infected Vero-CCL81 cells with wt or recombinant viruses at a multiplicity of infection (MOI) of 0.001, in triplicate. The infected cells and supernatant were harvested at 12, 24, 48, 72, 96, 120, and 144 hpi, respectively. After three cycles of freeze-thawing and sonication of infected cells, lysates were centrifuged to remove cellular debris, and the supernatant was collected. The titer (TCID50/ml) of each sample was measured using Vero-CCL81 cells.
Immunofluorescence assay (IFA)
8.5 ´ 104 Vero-E6 cells were seeded in 24 well plates with coverslips. After 18 hours, the cells were infected with the recovered MV-ZIKV viruses and controls at a MOI of 0.1 for 72 hours. The cells were permeabilized for 20 minutes at room temperature with BD Cytofix/Cytoperm (BD, 554714) and blocked with FACS buffer for 30 minutes. For Fig. 1B, Cells were stained with Biofront ZIKV-E mouse monoclonal antibody (1mg/mL) for 1 hour at room temperature (RT) on a rocker platform. Cells were washed 3X with FACS buffer and stained with secondary antibody Cy3-conjugated Goat Anti-mouse IgG (Jackson ImmunoResearch, 2 mg/mL in FACS buffer) for 1 hour at RT. For Fig. 3B, cells were stained with Biofront ZIKV-E mouse monoclonal antibody (1 mg/mL) and Anti-ZIKV NS1 human monoclonal antibody EB9 (2mg/mL) for 1 hour at room temperature (RT) on a rocker platform. Cells were washed 3X with FACS buffer and stained with secondary antibodies Alexa Fluor 568 -conjugated goat anti-mouse IgG (ThermoFisher Scientific, 2.5 mg/mL), and Alexa Fluor 647 conjugated goat a-human IgG (ThermoFisher Scientific, 2.5 mg/mL), for 1 hour at RT. For both Fig. 1B & 4B, cells were washed 3X with FACS buffer and stained with Anti MV-N cl25 mouse monoclonal antibody conjugated with Dylight 488 (5 mg /mL) at RT for 1 hour. Cells were washed 3X with FACS buffer and mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (H-1500). Images were taken using Nikon A1R+ confocal microscope.
Viral sucrose purification and Cell lysates
Larger amounts of MV-ZIKV and control MV supernatants were spun through a 20% sucrose cushion in an SW32 Ti rotor (Beckman, Inc.) at 25,000 rpm for 2 hours. ZIKV was spun through a 20% sucrose cushion at 30,000 rpm for 3.5 hours. Virion pellets were resuspended in phosphate-buffered saline (PBS), and protein concentrations were determined using a bicinchoninic acid (BCA) assay kit (Pierce). 6 well plates seeded with 0.7 x 106 Vero cells, 16 hours before they were infected with MV-ZIKV viruses and control viruses at a MOI of 5 for 60 hours and harvested using Sabatini Buffer (40mM Tris,ph7.6; 120 mM NaCl; 1mM TRITON-X100; 0.4mM Sodium Deoxycholate; 1mM EDTA), and protein concentrations were determined using a bicinchoninic acid (BCA) assay kit (Pierce).
Purification of Subviral particles (SVPs)
T175 flasks were infected with MV-ZIKV vaccines or controls at a MOI of 0.1. Larger amounts of MV-ZIKV and control MV and Zika virus supernatants were filtered through a 0.2 mm filter (Rapid-Flow™ Sterile Disposable Bottle Top Filters with PES Membrane). The 0.2 mm filtration step was aimed to filter most of the MV particles (pleomorphic, 100-300 nm) out of the supernatant. The filtered supernatant was then spun through a 20% sucrose cushion at 48,000 rpm for 3 hours in a SW55Ti rotor (Beckman Coulter). The SVP pellets were resuspended in a 4X non-reducing buffer (Alfa Aesar, ThermoFisher, Cat# J63615-AD) in a total volume of 100mL. SVPs for MV-E0 virus could not be purified and were therefore not included in this blot.
SDS-PAGE and Western Blot
The sucrose purified virus particles or cell lysates were denatured with 4X Laemmli Sample Buffer supplemented with 2-mercaptoethanol (10%) at 95°C for 10 minutes. 2.5 mg of sucrose purified virus or 5 mg of cell lysates or 10mL of the SVPs (in non-reducing buffer) was resolved on a 10% SDS–polyacrylamide gel and thereafter stained overnight with SYPRO Ruby for total protein analysis or transferred onto a nitrocellulose membrane in Towbin buffer (192 mM glycine, 25 mm Tris, 20% methanol) for Western blot analysis. The nitrocellulose membrane was then blocked in PBST (1X PBS, 0.05% Tween-20) containing 5% dried milk at room temperature for 1 hour. After blocking, the membrane was washed 3X with PBST and incubated overnight with Biofront ZIKV-E mouse monoclonal antibody (1mg/mL) or Anti MV-H Rabbit polyclonal sera (diluted 1:5000) or Anti MV-N cl25 mouse monoclonal antibody (1mg/mL) or Anti ZIKV-NS1 B4 mouse monoclonal antibody (1mg/mL) in 10% bovine serum albumin (BSA). After washing, the blot was incubated for 1 h with horseradish peroxidase (HRP)-conjugated anti-mouse/human/rabbit IgG diluted 1:20,000 in blocking buffer depending on the primary antibody used. Bands were developed with SuperSignal West Dura Extended duration substrate (Pierce).
ZIKV Envelope Antigen
Recombinant Zika Envelope protein antigen: The antigen used for ELISA and ELISPOT assay was purchased from Aalto BioRegents (AZ 6312).
Recombinant Measles virus H and ZIKV-NS1 antigen
A codon optimized MV-H gene (Edmonston B strain) was gene synthesized by GenScript. PCR amplification of the coding region of MV-H from the plasmid was performed using primers coMV-H61 N HA FWD (5’-TCGTGGTGCCAGATCTCACAGAGCCGCCATCTAT - 3’) and coMV-H61 N-HA REV (5’- TCTCGAGCGGCGGCCGCCTACCTTCTATTTGTGCCG -3’) to generate a fragment from amino acid 61 to 617 of MV-H protein (Supplemental Fig S9). The PCR amplified fragment was inserted by In-Fusion cloning (Stellar cells) into the pDisplay vector containing N terminal hemagglutinin (HA) tag that was cut with restriction enzymes BglII and NotI.
A codon optimized Zika prME-NS1 gene (strain PRVABC59 Asian 2015; GenBank: ANW07476.1) was gene synthesized by GenScript. The recombinant ZIKV-NS1 was constructed as published previously (13). Briefly, PCR amplification of the coding region of ZIKV-NS1 from the plasmid was performed using primers Sol coNS1 Fwd (5’- TGACGCACCTAGATCTAATGG
CTCCATCTCTCTGATGTGC - 3’) and Sol coNS1 Rev1 (5’- CGTATGGATAGTCGACAGCA
CGTCCTGCTGTCACCATAGAGCGGACC-3’) to generate a fragment that incorporated the last 24 amino acids of ZIKV envelope (NGSISLMCLALGGVLIFLSTAVSA) to the amino terminus of the NS1 coding region (Amino acid 1-352). The PCR amplified fragment was inserted by In-Fusion cloning (Stellar cells) into the pDisplay vector containing C terminal HA tag that was cut with restriction enzymes BglII and SalI.
Sub-confluent T175 flasks of 293T cells (human kidney cell line) were transfected with XtremeGene9 (150 mL/flask) and a pDisplay vector encoding either the codon optimized MV-H fused to an N-terminal HA tag (50mg/flask) or codon optimized ZIKV-NS1 fused to an C-terminal HA tag (50mg/flask). Supernatant was collected between days 7 post transfection and loaded onto two different equilibrated anti-HA agarose (Pierce) columns containing a 2.5-ml agarose bed volume. The supernatant is recirculated overnight at 4°C using a peristaltic pump at 1ml/minute. The column was washed with 10 bed volumes of PBS (0.05% Sodium Azide). After washing, antibody-bound MV-H was eluted with 5 ml of 250 μg/ml HA peptide in PBS. Fractions were collected and analyzed for MV-H by Western blotting with monoclonal anti-HA-7 antibody (Sigma) prepared in 10% BSA. Peak fractions were then pooled and dialyzed against PBS in 10,000 molecular weight cutoff (MWCO) dialysis cassettes (Thermo Scientific) to remove excess HA peptide. After dialysis, the protein was quantitated by UV spectrophotometry and frozen in small aliquots at −80°C.
Enzyme-linked immunosorbent assay
We tested individual mouse sera by enzyme-linked immunosorbent assay (ELISA) for the presence of IgG specific to ZIKV-E, ZIKV-NS1, and MV-H. To test for anti-ZIKV-E humoral responses, recombinant ZIKV-E (Alto BioRegents) was resuspended in a coating buffer (50 mM Na2CO3 [pH 9.6]) at a concentration of 1 μg /ml and then plated in 96-well ELISA MaxiSorp plates (Nunc) at 100 μl in each well. ZIKV-NS1 and MV-H were similarly resuspended in coating buffer (50 mM Na2CO3 [pH 9.6]) at a concentration of 1 μg/ml and then plated in 96-well ELISA MaxiSorp plates (Nunc) at 100 μl per well. After overnight incubation at 4°C, plates were washed three times with 1X PBST (0.05% Tween 20 in 1× PBS), which was followed by the addition of 250 μl blocking buffer (5% dry milk powder in 1× PBST) and incubation at room temperature for 1 hour. The plates were then washed three times with PBST and incubated overnight at 4°C with serial dilutions of sera in 1X PBST containing 0.5% BSA, 0.05% Sodium azide. Plates were washed three times the next day, followed by the addition of horseradish peroxidase-conjugated goat anti-mouse-IgG Fc secondary antibody (1:2000) (Southern Biotech, 1033-05). After incubation for 2 hours at room temperature, plates were washed three times with PBST, and 200 μl of o-phenylenediamine dihydrochloride (OPD) substrate (Sigma) was added to each well. The reaction was stopped by the addition of 50 μl of 3M H2SO4 per well. Optical density was measured at 490 nm (OD490) using BioTek Spectrophotometer. ELISA data were analyzed with GraphPad Prism 8. using a sigmoidal nonlinear fit model to determine the 50% effective concentration [EC50] titer. The EC50 titer is the concentration (dilution) at which the antibody/serum at which you get 50% of your maximal effect (Optical Density).
Zika neutralization assay
A FRNT measured ZIKV neutralizing antibody was performed as previously described (65) . Briefly, heat-inactivated (56°C, 30minutes) sera were serially diluted (three-fold) starting at a 1/30 dilution and incubated with 102 FFU of ZIKV (strain /PRVABC59/2015/P1 Vero) for 1 hour at 37°C. The ZIKV-serum mixtures were added to Vero cell monolayers in 96-well plates (1.2 ´ 104 Vero cells per well were seeded 16 hours prior to virus addition) and incubated for 1.5 h at 37°C, followed by overlaying the cells with 1% (w/v) methylcellulose in 1X DMEM (5%FBS). Cells were incubated for 40 hours at 37°C and subsequently fixed using 2% PFA in PBS for 1 hour at room temperature. Cells were permeabilized with Perm buffer (1X PBS, 5% FBS, 0.2% Triton X-100) for 20 minutes at 4°C and washed 3X with FACS buffer (1XPBS, 5% FBS, 0.05% Sodium azide). ZIKV-infected cell foci were detected using anti-Flavivirus E 4G2 mouse monoclonal antibody (1ug/mL), washed 3X with FACS buffer, followed by Cy3-conjugated Goat Anti-mouse IgG (Jackson ImmunoResearch, 2 mg/mL). After 3X washes with FACS buffer and plates were read using a fluorescence microscope. For Fig.s 5, 6, and 7, the 1st International Standard for anti-Asian lineage Zika virus antibody (NIBSC: 16/352) and Working reagent for anti-Zika virus antibody (NIBSC: 16/320) were used at a starting dilution of 1:100. The 50% reduction point (RP -Reciprocal of the dilution where 50% neutralization is observed) for the serum and standards were noted, and the FRNT50 titer was calculated as follows:
Measles neutralization assay
Measles neutralization assay was performed as described previously (66) . Sera and the 3rd International standard for Anti-Measles serum were heat-inactivated at 56°C for 30 minutes. In a 96 well plate, serum samples were diluted serially 4-fold from 1/10, and the 3rd International standard was diluted 1/100 in 1X DMEM (2% FBS, 1%PS) 70 ml and mixed with 30 ml volume of diluted virus solution (150 PFU/well ) of low-passage MV Edmonston strain (P1, Vero) in 1X DMEM (2% FBS, 1%PS) on a plate shaker at 37°C for 1 h. Then, 1.2´104 Vero cell suspension was added (100 ml) and incubated for 68 hours at 37°C. Cells were fixed with 80% acetone for 10 mins at 4°C. The fixation solution was aspirated, and plates were allowed to air dry. Cells were blocked for 1 hour in FACS buffer and stained with 100mL of Anti MV-N cl25 mouse monoclonal antibody (2 mg/mL in FACS buffer-1X PBS, 10%FBS, 0.05% sodium azide) for 2 hours. Plates were washed 3X with FACS buffer and stained with secondary antibody, Cy3-conjugated Goat Anti-mouse IgG (2 mg/mL in FACS buffer) for 2 hours. After 3X washes with FACS buffer and plates were read using a fluorescence microscope, the presence of the measles virus was detected by direct EIA as described above. All serum dilutions were tested in triplicate. The 50% reduction point (50%RP) of each serum was calculated using the Reed–Muench formula. The neutralizing antibody titer of test sera was converted into mIU/ml by comparing their 50% RP with that of the international standard serum using the following formula:
RNA extraction
Whole blood (50 µL) was resuspended in 150 µL of TRIzol LS Reagent (Life Technologies). All Organs were added to Omni pre-filled bead tubes containing 1mL of TRIzol and homogenized using the OMNI bead ruptor 12. The RNA extraction protocol for biological fluids using TRIzol LS Reagent was followed until the phase separation step. The remaining RNA extraction was done using the PureLink RNA Mini Kit (Ambion). The quantity and quality (260/280 ratios) of RNA extracted was measured using NanoDrop (Fisher).
Quantification of Zika virus RNA by quantitative Real-Time polymerase chain reaction
ZIKV cDNA was generated from RNA isolated from the ZIKV African MR766 strain and Asian PRVABC59 strain by One-Step RT PCR (SuperScript III, Thermo Fisher Scientific) with primers ZKV NS4B IVT F1 (5’-GAATTCTAATACGACTCACTATAGGGGCATCTAATGGGAAGG
AGA-3’) and ZKV NS4B IVT R1 (5’-GCTAGCGGCTGTAGAGGAGTTCCAGTA-3’). The African and Asian standards were generated by in-vitro transcription of the generated ZIKV cDNA, followed by using the MEGAclear Transcription Clean-Up Kit. Aliquots of 2 ´1010 copies/µL were frozen at –80°C. Five microliters of RNA per sample were run in triplicate, using the ZIKV-F2 (5’-CAGCTGGCATCATGAAGAATC-3’) and ZIKV-R1 (5’-CACTTGTCCCATC
TTCTTCTCC-3’) primers for African strain detection (ThermoFisher SCIENTIFIC) or the ZIKV-F1 (5’-CAGCTGGCATCATGAAGAACC-3’) and ZIKV-R2 (5’-CACCTGTCCCATCTTTTTC
TCC-3’) primers for Asian strain detection. The panZika-Probe (6FAMGTTGTGGATGGAATA
GTGGMGBFNQ) detects both the Asian and the African strain.
ELISPOT
An ELISPOT assay quantitated the number of ZIKV E, ZIKV-NS1, and MV-H specific LLPCs and SLPCs in the bone marrow and spleen, respectively, as previously described (67). ELISPOT plates (Millipore) were coated with ZIKV-E antigen (50 mg/mL), ZIKV-NS1 antigen (50 mg/mL) and MV-H antigen (10 mg/mL), overnight at 4°C. Subsequently, plates were washed six times with PBS (200 ml) and then blocked for 1-2 hours with Goat Serum (ThermoFisher Scientific, 16210072) at 37°C. Bone marrow cells from the femurs and splenocytes were harvested from the immunized mice and controls, and erythrocytes were lysed by ACK lysis buffer. Subsequently, 3 ´106 cells/well were added to the ZIKV-E, and ZIKV-NS1 coated plates, and 1 ´106 cells/well were added to the MV-H coated plates. Cells were serially diluted in a 96 well round bottom plate, transferred to the coated ELISPOT plate, and incubated overnight at 37°C in a CO2 incubator for 16 hours. Plates were washed four times with 1X PBST, incubated with HRP conjugated goat anti-mouse IgG-Fc (Sothern Biotech, 1mg/mL) in PBS-T for 2 hours at 37°C. Following 3X washing with 1X PBST, plates were washed 3X with PBS. Spots were developed with TrueBlue peroxidase substrate (KPL) before the reaction was quenched with water and counted with an AID EliSpot Reader (Autoimmun Diagnostika GmbH).
Statistical analysis
Specific statistical tests used to analyze experimental datasets are described in the respective Fig. Legends. For experiments with only female mice, antibody responses, and immune cell analyses, One-way ANOVA with posthoc Tukey HSD test was performed on log-transformed data for each time point. For data analysis where only two groups were compared, a Mann-Whitney U test was performed on log-transformed data for each time point. For experiments with female and male mice, antibody responses, and immune cell analyses, two-way ANOVA with posthoc Tukey HSD test was performed on log-transformed data for each time point. Survival curves were analyzed using the log-rank test with a Bonferroni correction. A P value of < 0.05 was assigned to establish statistical significance using GraphPad Prism version 8.0.