Materials
Chemicals and reagents including 2-BFI, pertussis toxin (PT), incomplete Freund’s adjuvant (IFA) and mycobacterium tuberculosis H37RA were obtained from Sigma Chemical Co. (Saint Louis, MO, USA). MOG35-55 (Myelin oligodendrocyte glycoprotein35–55 amino acid peptide, MEVGWYRSPFSRVVHLYRNGK, 95% purity or greater) was synthesized from Lianmei Chemical Co. (Xi’an, China). Percoll and red blood cell lysis buffer was purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA). Antibodies used in flow cytometry such as anti-CD4-FITC, anti-CD3-APC, anti-CD8-PE and anti-B220-PE-cy5.5 were obtained from Thermo Fisher Scientific Inc. (Waltham, MA, USA).
Mice and EAE induction
Female C57BL/6 mice, 6-8 weeks old, weighing 17-20 g were obtained from the Experimental Animal Center of Beijing Military Region and housed under specific pathogen-free conditions. Animals were maintained with free access to food and water. Each mouse received subcutaneously injections into multiple sites in the flanks with 0.2 mg of MOG35–55 emulsified in IFA supplemented with 8 mg/ml of heat-killed mycobacterium tuberculosis H37Ra (complete Freund’s adjuvant, CFA). In addition, 0.2 ml phosphate-buffered saline (PBS) containing 200 ng of PT were injected intraperitoneally (i.p.) at days 0 and 2 post-immunization. The body weight and clinical signs of EAE micewere examined every day.
2-BFI treatment and treatment groups
Twenty-four mice were randomly divided into three groups for the present experiments. EAE mice were subtyped into one 2-BFI-treated groups (EAE-2BFI group) and one saline-treated group (EAE-control group,). Mice in the EAE-2BFI group were given twice daily i.p. injection of 2BFI 20 mg /kg for 14 days from the day of immunization, while the EAE-control group mice were given twice daily i.p. injection of the same dose of saline. The remaining mice (CFA-control group) were immunized with only CFA and the equivalent amount of saline instead of MOG35–55 used in EAE mice.
Clinical and pathological evaluation of EAE
Clinical signs of neurological deficits were observed and evaluated daily, the severity was graded as follows scale [22]: (1) for the tail, 0 = no signs; 1 = half paralyzed tail; 2 = complete limp tail; (2) for each of the hind- or forelimbs assessed separately, 0 = no signs; 1 = a weak or altered gait; 2 = paresis; 3 = a fully paralyzed limb. The sum of the state of the tail and all four limbs was from 0 to 15, thus a fully paralyzed quadriplegic mouse would attain a score of 14. Mortality equals a score of 15.
EAE mice and CFA-control mice were euthanized at 20 days after immunization, approximately the peak clinical signs exhibited. The mice were perfused by intracardiac injection pre-cooling PBS, then the lumbar cords were dissected out and fixated in 4% paraformaldehyde for 12h. Transverse sections of the spinal cord were stained with H&E staining. The severity of inflammatory cell infiltration was assessed according to the following scoring system described by Okuda et al. [23]: 0 = no infiltration; 1 = slightly cellular infiltrates were around meninges; 2 = mild cellular infiltrates in parenchyma (1–10/section); 3 = cellular infiltrates in parenchyma (11–100/section); and 4 = severe cellular infiltrates in parenchyma (>100/section). The cerebral cortices of mice were sectioned and examined by LFB staining to evaluate the severity of demyelination. The LFB color intensities were recorded by Image J system and normalized to CFA-control group.
Isolation of mononuclear cells from the CNS and splenocytes
Fresh brain and spinal cord tissues were removed from mice and rinsed in ice-cold PBS. The brain and remaining spinal cord were cut into small pieces, using the back of a sterile 1 ml syringe plunger press each piece of organ filtered through a 100mm wire mesh in a 10cm petri dish containing 10ml of ice-cold PBS. The tissues were dispersed into a single cell suspension and inflammatory cells were recovered from the CNS, then centrifuged at 1, 500 rpm for 5 min at 4°C to resuspend the cells in 30% Percoll and then layered over 70% Percoll. The cells were collected from the 30%/70% interface after centrifugation at 600 g for 20 min at room temperature and washed twice with PBS. Spleens were removed from the same mice and placed in PBS. Tissues were forced through 100-mesh stainless steel screens to give a single cell suspension. Red blood cells in spleen cell preparations were lysed by red blood cell lysis buffer, and the cells were washed and resuspended in PBS. The total number of cells derived from each mouse was counted by a hemocytometer for further staining.
Fluorescence-activated cell sorting analysis
Spleen or CNS-derived inflammatory cells (0.5-1 × 106) were washed with PBS, then incubated for 30 min at room temperature in the dark with specified antibodies such as anti-CD4-FITC, anti-CD3-APC, anti-CD8-PE or anti-B220-PE-cy5.5. Nonspecific staining was determined by incubating cells with labeled isotype-matched. Staining kit were purchased from Thermo Fisher Scientific Inc. and used according to the manufacturer’s instructions. Data collection was performed using a fluorescence-activated cell sorting (FACS) Calibur flow cytometer (BD Biosciences, USA), and analyzed with Cell Quest.
Semi-quantitative RT-PCR
Total RNA was isolated from the brains of the mice with Trizol (Invitrogen, USA) in accordance with the manufacturer's guidelines. The total RNAs were reverse-transcribed (RT) to cDNA using a Gene Amp RNA PCR kit with oligo dT primer. PCR amplification of each cDNA target (IFN-γ, IL-10 and TGF-β) was performed from the same RT reaction according to the manual:
IFN-γ
|
forward 5'TCCTGCAGAGCCAGATTATCTCT 3'
reverse 5'ACCTCAAACTTGGCAATACTCATG 3'
|
169bp
|
TGF-β
|
forward 5'-TGGACCGCAACAACGCCATCTATGAGAAAACC-3',
reverse 5'- TGGAGCTGAAGCAATAGTTGGTATCCAGGGCT-3'
|
525bp
|
IL-10
|
forward 5'-GCTCTTACTGACTGGCATGAG3
reverse 5'-CGCAGCTCTAGGAGCATGTG3'
|
105bp
|
Amplification conditions including annealing temperatures, number of cycles, and extension times were optimized for each target. PCR products were run on a 1.5% agarose gel containing 0.5 μg/ml ethidium bromide, and were visualized under UV light. The density of the band was quantitated using a Digital Imaging System.
Statistics analysis
Data were analyzed by the SPSS statistical program. Quantitative results were expressed as mean ±standard deviation. Data comparison between two groups was analyzed by Student’s unpaired 2-tailed t test. One-way ANOVA was utilized for multiple group comparison followed by post hoc analysis with Dunnett’s test to identify significant groups. A P value less than 0.05 was taken as a significant difference for all statistical analyses.