Mice
Adult (2 to 10 months old) SAMP8 and SAMR1 mice were bred and maintained in the animal facilities at the Centro Nacional de Microbiología - Instituto de Salud Carlos III (CNM-ISCIII, Madrid, Spain). Male double transgenic APP/PS1 mice (10 months old), a cross between Tg2576 (overexpressing human APP695) and mutant PS1 (M146L), were kindly provided by Eva Carro [51]. All animal experiments were approved by the Institutional Review Board at the ISCIII and carried out in strict accordance with EU and National Animal Care guidelines. Protocols were approved by Consejería de Medio Ambiente Comunidad de Madrid (PROEX 179-14).
Tissue Processing
For confocal preparations, mice were deeply anesthetized by intraperitoneal (ip) injection of a mixture of ketamine and xylazine and transcardially perfused with 25–30 mL of saline solution for 5 min, followed by 10 min with 4% paraformaldehyde (PFA) from Sigma, pH 7.4, in 0.1 M phosphate buffer (PB, Sigma). After perfusion with the fixative, brains were dissected out and post fixed with 4% PFA for 18–20 h at 4ºC. After fixation, brains were rinsed in 0.1 M PB and placed in 15% glucose at 4ºC until they sank, and then in 30% sucrose in PB at 4ºC for 72 h. Finally, brains were embedded in tissue freezing medium (Tissue-Tek O.C.TTM, Sakura), by submerging brains in increasing concentrations of OCT, frozen immediately in dry-ice-cooled 2-methylbutane (Sigma), and stored at -80ºC. Coronal sections (30 m) were cut using a CM1950 cryostat (Leica Microsystems). Brain sections were collected sequentially in 10 slides. Six sections per slide generates antero-posterior reconstructions of the hippocampus conformed by 1 section every 300 μm of hippocampal structure and stored at -20ºC until use.
Periodic acid–Schiff (PAS) stain
Frozen brains embedded in OCT cryostat-embedding compound (Tissue-Tek) as before, were cut into 30m-thick sections on a cryostat (Leica) at −22◦C, and placed on slides. Sections of the central zone of the hippocampus (at about bregma −2.30) were selected according to mouse brain atlas. Brain sections were and hydrate to deionized water and immerse in 0,5% periodic acid for 5 minutes at room temperature (18–26°C). Slides were rinsed in several changes of distilled water and immersed in Schiff’s Reagent (Sigma) for 15 to 20 minutes at 4°C. Slides were rinsed in running tap water for 5 minutes. For nuclei staining, slides were counterstained in Hematoxylin Solution, Gill No. 3 (Thermo Fisher), for 90 seconds, rinsed with alcohol acid (0,5% HCl in EtOH) three times and a final rinsed with tap water. Finally, slices were dehydrated, cleared and mounted in DPX (Sigma-Aldrich) media.
Immunohistochemistry
Immunohistochemistry analyses were performed on frozen brain sections by standard indirect staining as in [52]. Antibodies were diluted in 0.1 M PB containing 1% Foetal Bovine serum (FBS) (Hyclone), 0.06% Triton‐X100 (Sigma), and 150 mM glycine (Merck). Rabbit anti‐Iba1 (1:100, Wako) was used to detect expression of bMyC, Rat anti‐mouse I‐A/I‐E (1:100, clone 2G9, B.D. Pharmingen) was used to detect antigen‐presenting cells, Mouse anti-phospho-Ser 139-Histone H2A-X (clon JBW301, Millipore) was used to analyze DNA damage. Alexa fluor 488 Donkey anti-rabbit, -rat, -mouse and Cy3 anti-rat antibodies (Jackson) were used as second antibodies. After staining, all sections and cells were mounted and preserved with 50% Mowiol (Polysciences), 2.5% DABCO (Sigma).
Confocal Microscopy and Analysis.
Images were acquired on a Leica Spectral SP5 confocal microscope. Brain maps were imaged using a 20X INM objective and a 1.7 digital zoom. Tissue images are tiles of 2-4 μm z-stacks and cell images are single 1-2 μm z stacks both captured on a Leica Spectral SP5 confocal microscope with a 40x and 63X oil objectives. Images are presented as average projections of z‐stacks and keeping parameters constant using negative control slides stained with primary antibody to identify potential nonspecific, background fluorescence. Exceptions are mentioned in Fig legends. Acquired z‐stacks were background‐subtracted with Leica LAS AF 2.6.3 software and secondary processed and analyzed using Adobe Photoshop CS3 (Adobe Systems) and ImageJ (National Institute of Health, http://rsb.info.nih.gov/ij) for ROI quantification and cell counting. For 3D reconstructions, the plugging 3D viewer for ImageJ was used.
Stereology and Statistical analysis.
Stereology was performed by the analysis of 5 to 6 coronal sections, 30 μm each, separated 300 μm one to each other. Sampling started at first appearance of the infrapyramidal blade of the dentate gyrus (DG). Antero-posterior Bregma coordinates of all 5 sections correspond approximately to -1.2 mm, -1.6 mm, -2 mm, -2,4 mm and -2,8 mm. Every quantification was normalized by the DG area of every section. Analysis of variance (ANOVA) was used for statistical analysis of differences between ages of the same strain. Post-hoc comparisons were performed using the Tukey test, and the Bonferroni correction was applied. Data were also analysed by 2-tailed Student t test (unpaired t test for analysis of both SAMR1 and SAMP8 strains of the same age). Data are presented as mean ± standard error of the mean (SEM) and n indicates the number of independent mice used per strain and age. A p value of <0.05 was considered as statistically significant.
Image analysis for morphometric parameters calculation.
Three-dimensional (3D) reconstruction of individual microglial cells Z-stack confocal images of around 30 μm thickness at intervals of 1 μm were taken at specified areas of SAM R1 and P8 brain of different age. 3D images were obtained by using the plugin 3D viewer of FIJI software (freely downloadable from http://fiji.sc/Fiji). To analyse spatial coverage of microglia we used the methods described in Baron et al 2014 modified. Briefly, brain sections from these mice were stained with Iba1, and two distinctive areas of the brain such as the hippocampal formation (Hpp) together with areas within this brain area: strata pyramidale (sp) and oriens (so) imaged with confocal microscopy as before. Then, grey-level maximum z projection images were set to eliminate background based on intensity threshold and converted to binary images, processed with the ‘skeletonize’ option in FIJI software, and further analysed with a modified Sholl’s analysis adapted for microglia as in [18, 53]. A representative heat-map image was generated based on 8-bit z-projection image using the 3D Surface Plot plug-in bundled in FIJI software. For morphometric parameters calculation, after tracing an individual microglial cell, we calculate the number of intersections between microglial processes and concentric circles originated from the center of individual cell we used the Sholl’s analysis plug-in (Ghosh Lab, UCSD, San Diego, CA, USA) bundled in FIJI. This was used to analyze the number of intersections in circles with a radius between 5um (starting radius) as minimal distance corresponding to the soma of the cell and the final radio which include the longest microglia branch (ending radius). We analysed at least 25 individual Iba-1+ cells from a total of three individual animals. We present the data by using polynomial regression and defining three parameters: critical value of the circle radius (which defines the place of a possible circle intersecting maximum number of dendrites); the maximum number of ramification intersections with the circles (counted for consecutive circles placed starting at the cell body to the border of the arborisation and the mean value of the fitted polynomial function (which describes an average property concerning numbers of branches of ramification tree over the whole region occupied by the ramification arbor). For that purpose, we also used the Sholl regression coefficient as well as the Schoenen ramification index similar to that described previously [54, 55].
LPS administration to mice
To assess the response of brain myeloid cells to peripheral immune stimulation, mice received a single intraperitoneal injection (i.p) of LPS from E. coli. #0111:B4; L4391-IMG (Sigma) of 0.5 to 1 mg/kg LPS. The LPS powder was dissolved in 0.9% endotoxin-free sterile saline at a concentration of 10 mg/ml. Mice injected with sterile saline as vehicle were used as control. Brains were collected and cells preparation and mRNA expression analyses as follow.
Cell Preparation
2 and 10 months old SAMP8 and SAMR1 mice (or otherwise specified) were sacrificed, and intracardiac perfusion was performed using phosphate buffered saline (PBS) with observed blanching of the spleen during 5 min at a speed of 5 mL/min. Complete brains were dissected and for most experiments meningeal (piamater) membranes and choroid plexus (m/Ch) were carefully removed with fine tweezers. Brain tissue was finely minced into small pieces and treated with a specific protease mix depending on the tissue. For brain without m/Ch, cells were prepared as in [52], brain, without the m/Ch and cerebellum, was digested in 5 mL of enzyme solution 20 units/mL papain (Worthington) and 0.025 units/mL DNAse (Sigma) in buffer containing 116 mM NaCl, 5.4 mM KCl, 26 mM NaHCO3, 1 mM NaH2PO4, 1.5 mM CaCl2, 1 mM MgSO4, 0.5 mM EDTA, 25 mM glucose, and 1 mM l‐cysteine, pH 7.5) for 30 min at room temperature (RT) with agitation. The brain homogenate was washed and filtered once through a 70‐μM filter to remove undigested fragments and then washed twice more, followed by centrifugation at 300g for 7 min. Cells were resuspended in 30% Percoll (GE Lifesciences) under 5 mL HBSS and centrifuged at 300g for 20 min at RT with slow acceleration and no brake. Pellets were collected and washed with ice-cold PBS containing 2% (vol/vol) FBS (spin 300g, 7 min). All subsequent washes were performed in this buffer. This preparation contains microglia/macrophage from brain as in [56], with the exception of those from meningeal membrane, choroid plexus, and cerebellum; we refer to this cell preparation as brain myeloid cells (bMyC) fom brain parenchyma (BP). For m/Ch cell isolates, meningeal membranes plus choroid plexus were collected in an Eppendorf containing 1 mL PBS. Tissue was treated with 2.5 mg/mL pronase (Roche) plus 0.025 units/mL DNase (Sigma) in PBS during 30 min at 37°C in a bath with mixing. This was followed by homogenization with gentle trituration using glass pipettes until an even homogenate was obtained. m/Ch homogenates were filtered and treated as above. All subsequent steps were performed at 4°C in PBS, 2% FBS.
CD45+ cell purification
After enrichment on Percoll gradient, brain isolated cells where purified using MACs LS columns from Miltenyi Biotec, following manufactures instructions. Cells were washed in PBS 2% FBS and resuspended in 180 L of PBS 0.5% BSA 2mM EDTA per brain sample, using MACs solutions, following manufacturer instructions. All steps were carried out on this buffer. CD45 mouse microbeads (20 L) where added to the cells and incubated on ice during 15 minutes. 5 mL where then added and cell suspension was centrifuged 10 minutes at 300 g. Supernatant was discarded and cells were resuspended in 5 mL and applied to the column, attached to MACs Separator and previously equilibrated with same buffer. Before column, cell preparation were filtered through 70m filter. Column was washed with 10 mL and cells where extracted from column in 5 mL according to Miltenyi protocol. Cells were centrifuged again and resuspended in 1 mL of PBS-Serum, counted in a Neubauer chamber and prepared for following applications.
Flow Cytometry
Single‐cell suspensions were prepared as above and resuspended in staining buffer (2.5% FBS in Dulbecco's PBS; Biowhittaker, Lonza Group). Nonspecific binding to Fcγ receptors was blocked with 10 μg/mL of 2.4G2 mAb (Fc block) (BD Biosciences). Staining was performed following standard protocols. Antibodies and reagents are listed in Supporting Information, Table 1. Fluorochrome‐labeled antibodies specific for mouse CD45, CD11b, P2RY12 and CD49d were from BD Biosciences or Biolegend. Cells were analyzed on a LRS Fortessa X-20 (BD Biosciences) cytometer, using the FlowJo v6.3.4 (TreeStar) and DIVA v8.0 software packages. The gating strategy used to exclude dead cells and doublets is presented in aditional Fig 2s
RNA isolation and Real-Time PCR
Total RNA was extracted with Tripure (Roche), and 2 g were reverse transcribed to cDNA with MMLV-RT (Invitrogen). Real-time quantitative PCR (qPCR) was carried out on 10-20 ng cDNA, using TaqMan probes and Sybr Green system (Applied Biosystems). qPCR reactions were run in duplicate in ABI Prism 7500 Fast Sequence Detection System (Applied Biosystems). Mouse primers used for Sybr Green assays were as follow, 36B4 was used as endogenous control.
36b4 Forward: AGATGCAGCAGATCCGCAT
Reverse: GTTCTTGCCCATCAGCACC
Il-1: Forward: CAACCAACAAGTGATATTCTCCATG
Reverse: GATCCACACTCTCCAGCTGCA
Tnf- Forward: TGGAACTGGCAGAAGAG
Reverse: CCATAGAACTGATGAGAGG
Il-6: Forward: GAGGATACCACTCCCAACAGACC
Reverse: AAGTGCATCATCGTTGTTCATACA
Ccl-2: Forward: CGGAACCAAATGAGATCAGAACCTAC
Reverse: GCTTCAGATTTACGGGTCAACTTCAC
Aif-1: Forward: GGGAAAGTCAGCCAGTCCT
Reverse: GCATCACTTCCACATCAGCTT
Cx3cr1 Forward: TCAGCATCGACCGGTACCTT
Reverse: CTGCACTGTCCGGTTGTTCA