Drug administration and Animal experiments
Sennoside A (CAS. 81-27-6; HPLC 98.58%; store at 2-8℃) studied in this article were purchased from Biopuify Phytochemicals Ltd., China.
Animal experiments were conducted in accordance with the Institutional Animal Care and Use Committees of Nanjing University of Chinese medicine and followed guidelines issued by the National Institutes of Health. Six-week-old C57BL/6J male mice (18 to 20 g) were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). Mice were housed under standard laboratory conditions (room temperature: (22±2) ℃; humidity: (50±5) %) with a light/dark cycle of 12/12 h. Before the experiment, they were acclimatized to the environment with free access to food and water for at least 3 days.
Animal protocol 1: Effects of Sennoside A on direct effect in mice
Mice were randomly distributed and plus daily administration of Sennoside A at 0, 25, 50, or 100 mg/kg by intragastric gavage for 12 weeks. Faecal sample from each group was collected weekly and stored at -80°C. Abundances were averaged across time points as shown in Figure 2&3. At the end of the experiment, the mice were sacrificed, and the blood and colon tissues were collected for analysis.
Animal protocol 2: Antibiotic treatment and fecal microbiota transplantation
For in vivo antibiotic protreatment, six-week-old male C57BL/6 J mice were supplemented with antibiotics vancomycin (0.5 g/liter), neomycin sulfate (1 g/liter), metronidazole (1 g/liter), and ampicillin (1 g/liter) in drinking water for five days.
After antibiotic treatment, fecal transplant was performed on the basis of an established protocol [41]. Briefly, 6-week-old male donor mice were given NS and Sennoside A (100mg/kg) for 12 weeks. During week 10 to week 12 (total of 14 days), faecal microbiota from each donor mouse was collected daily and stored at –80°C. The stools from donor mice of each group were pooled and 150–180 mg was resuspended in 1 ml of sterile saline. The solution was vigorously mixed for 10 s using a benchtop vortex (MS 3, IKA, Germany), and centrifuged at 800 g for 3 min. The supernatant was collected and used as transplant material as described below. Fresh transplant material was prepared on the same day of transplantation within 10 min before oral gavage to prevent changes in bacterial composition. Before being killed for subsequent analysis, six-week-old male recipient mice were inoculated weekly with fresh transplant material (100 μl for each mouse) by oral gavage for 12 weeks. (Figure 4)
Animal protocol 3: Butyrate supplement in Sennoside A-treated mice.
Mice were maintained on Sennoside A-treatment for four weeks and divided into two subgroups (10 mice/group). Two groups continued to be treated with Sennoside A and simultaneously drinked with 150 mM sodium butyrate or placebo for the last eight weeks according to our microbiota analysis of compositional dynamics, respectively.
Animal protocol 4: The effect of sennoside A on AOM/DSS-induced colon cancer in mice.
C57BL/6 male mice (age, 6 weeks) were treated daily with Sennoside A (100mg/kg) or saline by oral gavage throughout the experiment. After 1 week on intraperitoneal injection with AOM (10 mg/kg; Sigma-Aldrich), the mice were given 1.5% DSS in drinking water for 5 days followed by regular drinking water for 10 days. This cycle was repeated for three times and the mice were sacrificed for analysis of colon tumorigenesis at day 40 and 90 after the AOM injection.
Haematoxylin and eosin staining and histopathologic analysis
Fresh intestinal mouse tissue was fixed in Carnoy’s fixative solution (60% methanol, 30% chloroform, 10% glacial acetic acid) for at least 24 hours and processed into paraffin-embedded tissue sections. Post Carnoy’s fixation, tissues were sectioned at 5 μm thickness using standard protocols. To determine the extent of the damage, the H&E-stained slides were scored on a scale of 0-3 for four parameters: 3=markedly increased, 2=moderately increased, 1=slightly increased and 0=normal. The scoring parameters were the amount of crypt atrophy (including the number and depth of crypt), polymorphonuclear leukocyte infiltrate in crypt, the counts of goblet cells per crypt, Lymphocyte of basement of crypt and mucous membrane base.
The colonic mucus layer measurements
To measure the thickness of the colonic inner mucus layer, colonic tissues were sectioned at 5μm thickness, deparaffinized and stained using Alcian Blue staining kit (Leagene, Beijing, China) and anti-Muc2 (sc-515032, Santa cruz Biotechnology) immunofluorescent staining according to the manufacturer’s instructions.
Measurement of intestinal permeability with FITC-Dextran
Fluorescence detection in living, anesthetized mice was captured with a IVIS™ liveimaging system (IVIS Lumina III, PerkinElmer). Mice were gavaged with fluorescein-isothiocyanate (FITC)-dextran (4kDa; Sigma) at a doseage of 400mg/kg and then animals were studied 1 hr later using multispectral fluorescent capture. Blood samples were obtained after 4-5hr by retro-orbital bleeding, and the fluorescence intensity in the serum was measured at an excitation wavelength of 485 nm and an emission wavelength of 520 nm using a Microplate System (EnSpire, Perkin Elmer). FITC-dextran diluted in PBS was used to plot a standard curve, and the serum concentration of FITC-dextran was calculated. Furthermore, the mouse ileal-tissue sections were fixed with Carnoy's fluid and thin sections (~5 mm) were cut and deposited on glass slides. Images were acquired using Inverted fluorescence Microscope (Alexa Fluor 488, Axio vert A1, ZEISS).
Analysis of tight-junction proteins
The tissue sections and NCM-460 cell were immunostained with specific antibodies (claudin-1 (A-9) (mouse) Santa cruz sc-166338; ZO-1 (D6L1E) Rabbit mAb CST 13663 ; E-Cadherin (4A2) Mouse mAb, CST 14472) by incubating overnight at 4℃. Following antibody incubation, slides were incubated with Alexa Fluor 594 or 488 -conjugated secondary antibody for 2 hr at room temperature followed by washing three times with PBS (3 cycles, 5 min). The nuclei were stained with DAPI and slides were mounted in ProLong antifade reagent. Markings were detected and photographed by Inverted fluorescence Microscope (Axio vert A1, ZEISS).
To extract proteins from ileal epithelial cells, the epithelial cell fraction from ileal tissues were isolated. Total protein lysates were fractionate d by 10% SDS-PAGE and electro-blotted onto polyvinylidene difluoride membranes (Immobilon TM-P; Millipore, USA). Afterwards, the membranes were blocked with 5% non-fat milk for 1 h at room temperature in TBST buffer (10 mM Tris, 150 mM NaCl, pH 7.6, 0.1% Tween 20) and probed with primary antibodies overnight at 4°C. The membranes were then incubated with horseradish peroxidase-conjugated secondary antibody. The dilutions of primary and secondary antibodies have been described in the Antibody subsection above. Protein bands were developed using enhanced chemiluminescence reagent (Millipore). The blots were probed with the primary antibodies against GAPDH (Bioworld, China), claudin-1, ZO-1 and E-Cadherin (instrument same as above).
Bacterial Translocation by Fluorescent in situ hybridization (FISH)
Mucus immunostaining was paired with fluorescent in situ hybridization (FISH), as previously described [42], in order to analyze bacteria localization at the surface of the intestinal mucosa. Five-μm sections were cut and dewaxed by preheating at 60℃ for 10min, followed by bathing in xylene at 60℃ for 10 min, xylene at room temperature for 10min and 99.5% ethanol for 10min. After deparaniffization and rehydratation, sections were incubated in hybridization buffer [20 mM Tris-HCl, 0.9 M NaCl and 0.1% SDS (pH 7.2)] 10 min at 50℃. Next, sections were incubated with 100 nM EUB338I probe (Sequence 5’-GCT GCCTCC CGT AGG AGT-3’, FITC-conjugated, FB-0010B, EXONBIO) in hybridization buffer in the dark, overnight at 42℃ . After washing for 10min in wash buffer (20mM Tris-HCl, pH7.4, 0.9M NaCl) and 3×10min in PBS, Mucin 2 primary antibody was diluted to 1:200 in block solution and applied overnight at 4℃. After washing in PBS, block solution containing anti-mouse Alexa 594 secondary antibody (A-21203, Invitrogen) and Hoechst 33258 was applied to the section for 3h. Observations were performed with a Zeiss-Axio vert A1 microscope. The distance between bacterial populations and the epithelial surface was measured at four points of the proximal, middle and distal colon in each mouse.
Gut Microbiota Analysis by 16S Sequencing
Stool samples (n=5 per group) were snap-frozen in liquid nitrogen before storage at -80°C. Total genomic DNA was extracted from samples using the CTAB/SDS method. DNA concentration and purity were monitored on 1% agarose gel. According to the concentration, DNA was diluted to 1 ng/μl using sterile water. 16S rRNA genes were amplified using specific primer with the barcode. All PCR reactions were carried out in a 30 μL system comprising 15 μL of Phusion High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of forward and reverse primers, and about 10 ng template DNA. The thermal cycling consisted of initial denaturation at 95°C for 3 min, followed by 25 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and elongation at 72°C for 30 s, and finally at 16°C for 2 min. The V3 and V4 hypervariable regions of the 16sRNA gene were amplified. The same volumes of 1´ loading buffer (containing SYB green) and PCR products were mixed, and electrophoresis was performed on 2% agarose gel. Samples with bright main strip between 460 bp (V3+V4) were chosen for further experiments. PCR products were mixed in equidensity ratios. Then, the mixture of PCR products was purified with GeneJET Gel Extraction Kit (Thermo Fisher Scientific, USA). Sequencing libraries were generated using NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations and index codes were added. The library quality was assessed on Qubit@ 2.0 Fluorometer (Life Technologies, CA, USA) and Agilent Bioanalyzer 2100 system. At last, the library was sequenced on an Illumina MiSeq platform and 250 bp paired-end reads were generated.
Quality filtered reads were analyzed with the software package QIIME[43] High-quality reads for bioinformatics analysis were selected, and all of the valid reads from all samples were clustered into operational taxonomic units (OTUs) based on 97% sequence similarity. α-Diversity was calculated based on the Chao1 diversity index. The variation between the experimental groups (β-diversity) was assessed with principal coordinate analysis (PCoA) plots. Bacterial genuses with statistically significant difference were assessed using linear discriminant analysis effect size (LefSe)(http://huttenhower.sph.harvard.edu/galaxy)
Bacterial Growth Assays in corresponding treatment
Bacterial strains and culture conditions:
Akkermansia muciniphila , type strain, DMS 22959. The strain was cultured in 37℃,10% H2, 5% CO2 and 85% N2, medium 1203 +0.05% mucin
Clostridium tyrobutyrate, ATCC25755. The strain was cultured in 37℃, 0% H2, 5% CO2 and 85% N2, medium 2107
Clostridium butyricum, ATCC19398. The strain was cultured in 37℃, 0% H2, 5% CO2 and 85% N2, medium 2107
Experimental Design: A total of three in-vitro experiments (Experiments 1-3) were performed- details of the experimental replication are provided in the corresponding figure legends.
In-vitro Experiment 1, culture medium(CM) of bacterial growth condition was prepared in the following protocol: fresh faeces pellets from normal donor mice(50-100mg in 1ml PBS)→vortexing for 30min→ centrifuging 10min at 1000 g to remove faecal fibrous solids and collect bacteria-contained supernatants(500μl)→ supernatants supplemented LB medium(200μl) and treated with Sennoside A(1mg/ml)→ stationary incubation at 37°C for 4 hours under anaerobic atmosphere→centrifuging 10 min at 15000g to collect bacteria-free supernatants→ vacuum centrifugal concentration for ~8-12h→ resuspended in 1mL of corresponding strain medium (100%SenA-CM)→ A ten ponit concentration(%SenA-CM) using 2-fold serial dilutions was perpared.
In-vitro Experiment 2&3, all species were evaluated in different concentrations of compound prototypes (Sennoside A & Rhein).
All species were cultured in micro-anaerobic incubation system (ELECTROTEK, AW500SG/TG), and maintained at 37°C in a humidified incubator containing 10% H2, 5% CO2 and 85% N2. Absorbance values were measured at 600nm (A600) at an interval of 12 hr over 36 hr except for Akkermansia muciniphila, for which the absorbance was measured over 72 hr, owing to its relatively slow growth.
Notes: The color of compounds (Sennoside A and Rhein) seriously affects the absorbance value of OD600. Therefore, the drug solution of different concentrations without bacteria (SenA, Sen A-CM, Rhein) was used as blank (see Table S1 for compositions of all growth media used in this study)
Quantification of Short-Chain Fatty Acids by GC-MS
Fecal samples stored at -80℃ were used to quantify short-chain fatty acids (SCFAs) including acetate, propionate, butyrate, valeric acid, isovalerate, and isobutyrate. Samples were first thawed on wet ice. Then, an equivalent amount of 0.05M NaOH was added (100 ul per 100 mg of material) to cecal contents (≥0.05 g) and the samples were thoroughly homogenized by vortexing for 20 min. Supernatants (500μl) were prepared by reconstituting all cecal content of each animal with 10μl of internal standard (d3-caproic acid, 500μg/ml), followed by centrifugation at 13000rpm for 10 min at 4°C. The mixture(supernatants-internal standard-NaOH) were kept on ice or frozen until quantification of SCFAs by GC-MS. The mixture was transferred to the glass tube, added with Milli-Q water and vortexed for 30 seconds. The SCFAs were extracted through the addition of 300 μL 1-propanol, 200μl pyridine and 150μl of propyl chlorocarbonate by vortex mixing for 1 min. After that, 500μl of hexyl hydride were added to the mixture, vortexed for 1min, and centrifuge at 3000rpm for 5min. The extracted samples were measured using a ISQ GC–MS (Thermo Fisher Scientific, Waltham, MA, USA) as described previously with a TR -SQC capillary column (15m× 0.25mm)).Helium was used as the carrier gas and injections(1 μl) were made in the split mode (10:1 split). Oven emperature was set at 50℃ and maintained for 10 min, raised to 70°C at 10°C/min, increased to 85°C at 3°C/min, elevated to 110℃ at 5°C/min, up to 290℃ at 30°C/min and held at this temperature for 8 min. Detector temperature was set at 290°C and the injector temperature was 260°C. SCFAs standards were mixtures of acetate, propionate, butyrate, isobutyrate, valerate, and isovalerate. All the Standards were purchased from Merck (Darmstadt, Germany).The concentrations of SCFAs were calculated by the standard curve method. The reported values were normalized according to the wet weight of the original fecal sample used.
Metabolomics analysis.
For fecal metabolomics, approximate 50 mg fecal content for each mouse were collected at the end of experiment and added 0.8 ml ultrapure water containing 6 μg 1,2-13C2-myristic as an internal standard, vortex for 5 min, followed by centrifugation for 10 min at 13000 g. The supernatants were transferred to a new 1.5 ml tube. 400 μL of supernatants were dried in a SpeedVac sample concentrator and combined with 60 μL methoxyamine hydrochloride in pyridine (10mg/mL), then vortexed for 3 min and shaken at 30 °C for 90 min. 60 μL of BSTFA containing 1% TMCS were added to the sample and shaken at 30 °C for another 60 min. The mixture was then transferred to a sampler vial with a glass insert and subjected to GC–MS analysis. Quality control (QC) samples were prepared by pooling aliquots of all the fecal samples and were processed using same procedure as that for the experimental samples. Analysis was performed on a TRACE 1310 gas chromatograph equipped with an AS 1310 autosampler connected to a TSQ 8000 triple quadrupole mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) as described previously[44]. Helium was used as the carrier gas, and was maintained at a constant flow of 1.2 mL/min. The oven temperature was initially maintained at 60 °C for 1 min, then increased to 320 °C at 20 °C/min, and then held constant for 5 min. The transfer line temperature between the gas chromatograph and the mass spectrometer was set to 250 °C. Electron impact ionization at 70 eV was employed, with an ion source temperature of 280 °C. Mass spectra were acquired with a scan range of 50–500 m/z and a time range of 3.5–19 min. Raw data were acquired from Xcalibur 2.2 software (Thermo Fisher Scientific) and metabolites were identified through matching of their mass spectra against the reference spectra in the NIST 2014 standard database built-in Xcalibur 2.2 software. Metabolic analyses were performed using MetaboAnalyst 4.0 (https://www.metaboanalyst.ca/). Differential metabolites were identified by fold change>2 and p value<0.05. Pathway enrichment analysis were carried out based on the above differential metabolites.
ELISA for Fecal Lipocalin
Frozen fecal samples (-80℃ stored) were used to determine the levels of fecal Lipocalin (LCN2). The assays were performed within 30 days of sample collection. The samples were prepared as mentioned previously[45], with a few modifications in the sample prepration protocol: fecal samples were thawed on wet ice and 40-70 mg of samples were separated in fresh tubes, to which 0.6 mL of 1% (v/v) Tween 20 (Sigma-Aldrich, USA) prepared in PBS was added. To get a homogeneous suspension, the samples were vortexed for 20 min. The suspension was then centrifuged at 4℃ for 10 min at 14000 rpm. Next, the supernatant was carefully recovered and stored at -20℃ until the analysis. To measure the LCN2 levels, a mouse Mouse Lipocalin-2/NGAL DuoSet ELISA (R&D systems, Cat.No.DY1857) was employed and the manufacturer’s protocol was followed.
Measurement of cytokines in serum.
Cytokines and chemokines were measured a Luminex-100 system and the XMap Platform (Luminex Corporation). Each sample was run in duplicate in a 96-well micro titer plate using 25 μl serum using MILLIPLEX MAP Mouse Cytokine/Chemokine Magnetic Bead Panel (MCYTOMAG-70K-10, Millipore) containing KC, MIP-2, IFN-γ, IL-4, IL-6, GM-CSF, IL-1β, IL-17, IL-10 and TNF-α according to the manufacturer’s instructions . Quality control of each sample was performed, and a bead count of < 50 was not used for analysis. The experimental design for the Luminex assay was carried out using PlateDesigner (platedesigner.net) with samples from the same patient being randomly allocated to a plate and well, guaranteeing that if technical confounders exist they can properly be adjusted for in the analysis steps[46].
Flow cytometry analysis.
Cells were isolated from mesenteric lymph nodes (mLNs) followed by tissue mashing through 100 μm cell strainers. Cells were counted and stimulated using Cell stimulation Cocktail plus transport inhibitors 500× (eBioscience,cat. no. 00-4975-93) for 4 h in complete RPMI1640 containing 10% FBS. After stimulation, cells were harvested, fixed using IC fixation buffer and permeabilized using 1× permeabilization buffer (eBioscience). The following antibody clones were used: anti-CD3-APC (eBioscience, 17-0032-82), anti-CD4-FITC (eBioscience, cat. no. MA5-17443) and IL-17A-PerCP-Cyanine5.5 (eBioscience, 45-7177-82), IL-4-PE-Cy7 (8D4-8) (ebioscience, cat. no. 25-7049), IFN gamma PE(XMG1.2) (ebioscience, cat. no. 12-7311-82). Single cell suspensions were examined using BD Accuri C6 and the data were analyzed using C6 software and ata analyzed using FlowJo software.
Bacterial quantification by qPCR.
In addition to 16srDNA sequencing of the relative abundance of Akkermansia muciniphila, as a second approach to absolute quantification assay in fecal samples, phylotype-specific bacterial primers were designed. Total bacterial DNA was isolated from weighted faeces using E.Z.N.A Stool DNA KIT (Omega Bio-tek, USA). qPCR on a 7500 Sequence Detector (Applied Biosystems, CA, USA) was used to calculate the number of A. municiphila. DNA was then subjected to quantitative PCR using ChamQ SYBR qPCR Master Mix (Low ROX Premixed) (Vazyme, Shanghai, China) with following primers: Amuc_1599F (GACCGGCATGTTCAAGCAGACT) and Amuc_1599R (AAGCCGCATTGGGATTATTTGTT) to measure[45]. Standard curves for quantification consisted of ten-fold serial dilutions in the range of 108–101 copies of the 16S rRNA gene of the stool samples. Results are expressed as bacteria number per mg of stool, using a standard curve.
Statistical analysis
Unless otherwise stated in individual method sections above, statistical analysis was performed using GraphPad Prism V.7.0a. The results represent data from multiple independent experiments. Data were expressed as mean ± standard deviation (SD) or tandard error of the mean (SEM). The data were analyzed using two-tailed student's t test (for two groups) and one-way analysis of variance (ANOVA) (for multiple groups). Statistically significancecewas shown with asterisks as follows: *p < 0.05, **p < 0.01, and ***p < 0.001.