1. Mice
BALB/c and C57 mice (male, 6-8 weeks) were bought form Charles river (Beijing) and housed under SPF conditions attach to National Beijing Center for Drug Safety Evaluation and Research.
2. Mouse whole blood collection and storage
The whole blood of C57BL/6 mice was collected by cardiac puncture. The CPDA-1 solution with a final concentration as 14% was used for anticoagulation and storage. All the procedures during the blood collection were abode by the principle of sterility strictly. Whole blood was pooled in 50 ml sterile tube (Corning) and stored at 4°C protecting from light. An NWF Leukocyte Reduction Filter (KaiNuo. Biotech Corporation, China) was used for the leucocyte filtration of fresh and stored whole blood.
For the separation of platelet-containing plasma, the whole blood was centrifuged at 200g for 15 minutes, and the supernatant was collected as much as possible which contain the large amount of the platelet. After that, the platelet-containing plasma was centrifuged again at 200g for 15 minutes in a sharp bottom EP sample tube for the removal of residual RBC.
For the separation of RBC, the whole blood was centrifuged at 400g for 15 minutes after the leukocyte depletion. Then, the supernatant was discarded and the layer of residual leukocyte was also thrown away accompanied by partial loss of RBC inevitably. After that, the separated RBC was washed by 10 volume of normal saline 3 times and resuspend with normal saline before transfusion.
3. Quality control of the stored whole blood
The detection of hemolysis ratio before transfusion. The blood samples were mix thoroughly by inverting 4-6 times slightly. After that, the hemoglobin concentration and hematocrit were detected by using an automated hematology analyzer (Mindray, BC-2800Vet). The hemoglobin concentration in the supernatant after the centrifugation of mixed SWB represented the free hemoglobin concentrations which is detected by a free hemoglobin assay kit (Nanjing Jiancheng Bioengineering Institute, A071-1-1). The hemolysis ratio was calculated by the following formula:
![](https://myfiles.space/user_files/58894_9946feeafa4c1df7/58894_custom_files/img1600317300.JPG)
The bacterial contamination in the SWB was evaluated by the inoculated of 500 μl whole blood into LB Solid Medium for 5 days in 37 ℃ incubator.
4. Hydrodynamic based gene delivery and bioluminescence imaging.
The pSAA-Luc plasmid was a kindly gift from Ning Zhang. This plasmid was built by inserting an SAA promoter in front of Luc sequence in a pGL3-Basic vector. Hydrodynamic based gene delivery namely 10% mouse weight volume of normal saline that containing 10 μg naked plasmid was injected through the tail vein rapidly[21]. The bioluminescence imaging was conduct under IVIS Lumina Ⅱ (PerkinElmer, Inc.).
5. Elisa
The SAA, IL-1β, IL-6 and TNF-α Elisa kit was bought from R&D systems (MSAA00, MLB00C, M6000B, and MTA00B). The procedure of the Elisa detection was carried out in strict accordance with the operation manual. The OD value in 450nm and 570 nm was read by a MD5 microplate reader.
6. RT-PCR
TRIzol Reagent (Invitrogen, 15596018) was used for the extraction of high-quality total RNA. After that, 1 μg RNA was reverse transcribed into cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO), and amplification of the cDNA was performed for 40 cycles using THUNDERBIRD SYBR qPCR Mix (TOYOBO). 2−ΔΔCt method was used to evaluated the relative expression of the target gene. The primer sequences were listed as Table 1.
Table 1: Sequences of primers for RT-PCR.
|
Forward (5’-3’)
|
Reverse (5’-3’)
|
Luciferase
|
ATACCGGGAAAACGCTGGGC-
|
TCAAGGCGTTGGTCGCTTCC
|
IL-1β
|
CTCCACCTCAATGGACAGAA
|
GCCGTCTTTCATTACACAGG
|
TNF-α
|
AATGGCCTCCCTCTCATCAGTT
|
CCACTTGGTGGTTTGCTACGA
|
NOS2
|
AATCTTGGAGCGAGTTGTGG
|
CAGGAAGTAGGTGAGGGCTTG
|
Arg1
|
CTCCAAGCCAAAGTCCTTAGAG
|
AGGAGCTGTCATTAGGGACATC
|
Mgl1
|
TGGCCTGAAGCTGACAAGTA
|
AGGCCGATCCAACTAACCACAT
|
Mrc2
|
TGCAAGCAATGCATCCAAGCCT
|
ACGGCTTTCCGTGTGAGTTT
|
Actin
|
GCTTCTTTGCAGCTCCTTCGT
|
GACCCATTCCCACCATCACA
|
7. Separation and induction of BMDMs
The femur was separated from BALB/c mice after carbon dioxide euthanasia. Then, the bone marrow was collected by flushing out with a syringe filled with pre-cold 1640 complete medium (10% fetal bovine serum). After that, the cell suspension was obtained by gently dispersed with pipettor and filtration. All of the steps were performed on ice for the improvement of cell viability. The cell suspension was then incubated in 1640 complete medium and 50 ng/mL macrophage colony-stimulating factor (M-CSF, PeproTech, 315-03-100) for 6 d at 37℃ in a humidified atmosphere condition filled with 5% CO2. During the incubation and induction, fresh medium with 50 ng/ml M-CSF was added at day 3 and day 5. The BMDMs were ready for use after 6 days of incubation.
8. Preparation of Primary Kupffer cells
Mice were anesthetized and livers were perfused with 37 ℃ preheating in 20 mL D-Hanks (Solarbio, H1045) buffer solution at a rate of 5 ml/min, and then with 37 ℃ preheating in Hanks (Solarbio, H1025) buffer solution containing 100 U/mL collagenase type IV (Sigma) at a rate of 2 mL/min. The perfusate buffer solution enters the liver through portal vein (PV) and flows out through the inferior vena cava (IVC). The actual duration of 2 ml/min digestion with collagenase type IV was within 6 minutes with periodically applying pressure to the IVC (4-5 seconds each time). The liver would expand and shrink with the repeated pressure to the IVC which could improve the efficiency of digestion. After perfusion of the liver with collagenase type IV, the non-parenchymal cells were separated from hepatocyte by repeated low speed centrifugation, and then the cells were re-suspended by PBS and located on the upper layer of 11.5% and 20% OptiPrep, respectively. After centrifugation (4 ℃, 15min, 400g), the upper layer of 20% OptiPrep contained the majority of Kupffer cell and other non‐parenchymal cells. We purified Kupffer cell by selective adherence that removed unattached cells thoroughly after 1 h incubation in DMEM complete medium (10% fetal bovine serum) at 37 ℃ in a humidified atmosphere filled with 5% CO2. Cell viabilities of the primary Kupffer cells were more than 80% and 90%, respectively, in all experiments.
9. Statistical analysis
All of the data were presented as Mean ± SD. The statistical comparisons between different groups were introduced in legend respectively.