2.1. CCl4-induced hepatic fibrosis
Animal experiments were conducted with approval from the Experimental Animal Committee of Shanghai Municipal Hospital of Traditional Chinese Medicine, Shanghai University of Traditional Chinese Medicine, and all experiments were completed in the animal laboratory of our hospital. The C57 mice (male, 25-30g, 6–8 w) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). CCl4 (56-23-5) was obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China) and olive oil was obtained from Solarbio (Beijing, China). All mice were randomly divided into three groups (n = 5 of each group): 1) control group, the control mice were injected with commensurable olive twice a week for six weeks, and CCl4-induced group and SSd treatment group mice were intraperitoneal injected CCl4 (0.8ml/kg) twice a week for 6 weeks. At the same time, SSd treatment group mice were administered SSd (19810421, Wako Pure Chemical Industries, Ltd, Japan) daily, by intraperitoneal injection at a dosage of 2.0 mg/kg for 6 weeks.
2.2. Primary HSCs isolation and Cell Culture
HSCs were isolated from male C57 mice according to previously reports [33]. Briefly, the mice were sacrificed by cervical dislocation after anesthetizing with a mixture of Ketamine (75 mg/kg) and Medetomidine (1 mg/kg), and then the liver was perfused by portal vein using Pronase-E (Sigma- Aldrich) and collagenase (A005275, Sangon Biotech, Shanghai, China). The HSCs population was separated through density centrifugation with Nycodenz solution (Axis Shield POC, Oslo, Norway). Isolated HSCs were cultured in DMEM/F12 (Sigma) supplemented with 20% FBS, 1% penicillin-streptomycin in the humidified 5% CO2 incubator at 37°C.
Human Hepatic Stellate Cells LX-2, obtained from Merck Millipore (SCC064, Temecula, California, USA), were cultured in DMEM supplemented with 2% FBS and 1% penicillin-streptomycin at 37°C in a humidified atmosphere containing 5% CO2. LX-2 cells were treated with 5 ng/ml TGF-β (Beyotime, Shanghai, China) for 24 h.
2.3. Sirius red and Masson staining
The liver tissues were fixed with 10% formaldehyde, embedded in paraffin and cut into 5-µm sections. Then the sections were stained in 1% Sirius red solution or Masson solution for 1 hour or Masson solution for 5 min, observed using a microscope (Olympus, Tokyo, Japan).
2.4. Immunohistochemistry (IHC)
The liver tissues were fixed with buffered formalin (10%), embedded in paraffin, and cut into 4 µm-thick sections. The slices were incubated with citrate buffer (pH 6.0) for 5 min at 108°C, pretreated with 3% hydrogen peroxide (H2O2) for 15 min at room temperature and washed with PBS. Then, the slices were incubated with normal goat serum for 20 min, followed by incubation with primary antibody against αSMA (1:500, ab108424, Abcam), Col1α1 (1:50, PA5-36227, Invitrogen) and BECN1 (1:100, ab210498, Abcam) overnight at 4°C. Besides, the slices were incubated with secondary antibody (1:500, horseradish peroxidase-conjugated anti-rabbit IgG) and the reaction products were visualized with DAB solution.
2.5. Immunofluorescence (IF)
LX-2 cells were fixed with 4% paraformaldehyde for 0.5 h at room temperature and followed by washing 3 times in PBS. Next, cells were blocked with PBS supplemented 5% FBS and 0.2% Triton X-100 for 1 h at room temperature, and then incubated with anti-LC3 antibody (1 µg/ml; ab48394; Abcam) overnight at 4°C. After washing, the slides were incubated with goat anti-rabbit antibody (1:2000; A27039; Invitrogen) for 2 h at room temperature without light. The slides were washed 3 times in PBS and stained with DAPI (Solarbio) to visualize the nucleus. Finally, the slides were washed, mounted with glycerin, and analyzed using a confocal microscopy (Thorlars, Newtown, New Jersey, USA).
2.6. Quantitative real-time pCR (qPCR)
Total RNA was separated with Trizol reagent (Sigma-Aldrich, St. Louis, MO, USA) as instructed by the manufacturer. Reverse transcriptional PCR was performed using the iScripe™ cDNA Synthesis kit (Bio-Rad). qPCR was performed on ABI 7500-Fast Real-Time PCR System (Applied Biosystem, Foster City, CA, USA) with LightCycler 480 SYBR Mix (Roche). The fold changes of RNA transcripts were calculated by the 2−ΔΔCt method and the β-actin was used as a reference gene. COL1A1 F ACGGCTCAGAGTCACCCA; COL1A1 R CCTCCGGTTGATTTCTCATCATA; α-SMA F TCCCTTGAGAAGAGTTACGAGTT; α‐SMA R ATGATGCTGTTGTAGGTGGTT; ERα, F AGTGAAGCCTCAATGATGGG, ERα, R CAAAGATCTCCACCATGCCT; ERβ, F CTACTGAACGCGGTGACAGA, ERβ, R CGTGTCAGCATTCAGCATCT; GPER1, F CCATCATCGGCCTGTGCTAT, GPER1, R GAAGACAAGGACCACTGCGA; β-actin F CTTAGTTGCGTTACACCCTTTCTTGA; β-actin R CTGTCACCTTCACCGTTCCAGTTT.
2.7. Western Blot analysis
The LX-2 cells or liver tissues from CCl4-induced or SSd treatment mice were lysed using RIPA Buffer (Solarbio, Beijing, China), and the total protein concentration was detected by BCA protein assay kit (Cell Signaling Technology, Danvers, MA, USA). The proteins were separated by 10% SDS-PAGE, and then transferred to PVDF membranes (Merck Millipore, Billerica, MA, USA). After blocking with 5% nonfat milk in TBST, the membranes were incubated with primary antibodies against p62 (1:2000, ab109012, Abcam), LC3 (2 µg/ml, ab128025, Abcam), GPER1 (1:1000, ab260033, Abcam), α-SMA (1:1000, ab108424, Abcam) and β-actin (1:5000, ab6276, Abcam) overnight at 4°C. The blots were incubated with HRP-conjugated secondary anti-rabbit (1:5000) for 1 h at room temperature. Lastly, Immunoreactivities were visualized by chemiluminescence using the ECL kit (Pierce, Rockford, IL, USA). The intensity of protein bands on the Western blot image was quantified using ImageJ software.
2.8. Cell vitality
Cell Counting Kit-8 (CCK-8) assay was applied to measure LX-2 cell viability using CCK-8 kit (Solarbio, Beijing, China). Cells were plated at 4×103 cells per well in 96-well plates and treated with 5 ng/ml TGF-β and SSd (5 µM), G15 (100 nM) or Rapa (100 nM) for 24 h. After that, the cells were incubated with 10 µL CCK-8 for another 2 h at 37°C. The absorbance was measured at 450 nm with a microplate reader (Bio-Rad, Hercules, CA, USA).
2.9. Statistical analysis
Data are expressed as mean ± SEM. All statistics were carried out with SPSS 13.0 (IBM, Armonk, NY, USA). The difference between two groups was compared using two-tailed student’s t-test, or one-way analysis of variance (ANOVA) followed by the Scheffé test. P-values less than 0.05 were considered statistically significant.